Description :
From Genome Similarity Track
Location :
Scaffold_1674:4552- 6056
Transcript NameFunction/comments
Phyta_totarag13477hypothetical protein PHYSODRAFT_332303

Sequence
1504 bases(100 bases per row)
GAGGCGGTGAATTTGGTCAAGCTATTGCATAGAGAGGCGACTGGAGGAGACATACTCCGGGCGATTGAAGACGAGCGCGTGCGGACCGTCTCGCCAGAGG
ATCAACGGAACTTCCTGCAGTTCAACATGTTCTACACGTTTCGAAAGCAATGCTTGTTTTTGCCCACCCAGACCTCATGCGTCAGATGCGGTACAAAGGT
GTCACGCTGTTCGTCGATGCAACATTCAAGATTACTCCAGTGCCATTTTCGCAGACACTAATCGTCATGCTCTACAACCGTGCCCATGACATGTATCTTC
CGGTATTCTTCGTGCTGATGGATTCCAAAGATCACTAGAGTTACTACCACGCGTTCCAGTGGATTCGAGTTCAGTGTGAACAACGTTGCATGCCTTCAGT
CGTAATTTGTGACTTCGAAAGCGCGCTCCAACAAGCCGTTCGGGACCATTTCCCTGTGGCTTTCATTGTGGGGTGTCTTTTCCACTGGAAACAGGCGATA
AGAAGAAAAACGCTTTCGCTTGGAATCCCAGTTGAGCAGATCAGACTCACGACGGAGACGTCAAGCCTAGACACCCTCACAGTGATTCCGGAGGACCAGA
TTCTCAGTAAGGGCATTCCATACGTGGTGCAAAATCTATATCCGCGGATCGACCGAGCAGGACTCAAAACCAAGTGGGACAAGTTCTGCAAGTATTTCAA
GGATACGTGGACCATCCTGTACAAGCCCAGTTGCTGGAACATTTCAGCCATGCAAGAAGCTCAGGTTTCGCTTGTGAACCGAACAAACAACCCACTAGAA
GCTTACAACAGGGCGCTAGCTGACCGACTTGGCACGACGCATCCACCGCTGTTAACCTTCATCAGTGAGATCGAGGGGGAATGTGCAAGATACCTGCGGT
TGCTGCACGATATCCGCTTCGGTCGCGCTGATGAGATTCGAGAAAACCCCTGCACTACCCCCCTGTTCCAGATCTGGAGTGAACCTGTATTTCACGCTCT
GTCCGCTCAAATCCCCCCCTATATTTATATATCACTGGACGTATCGAGCGCTTTTTAAATTGAACACTCATTTTTACCCTTTGAAATGGTTTAACCTAGC
ATTAATGAAATACTTCATGACGCATAATAAAACGCAATTTTACTCTGCACCTATCCAGTTTTGATTGCAGAGCCAAATACTAAGCCTCCACCCCTATACG
CACTGAAGGTCCTTCACCTTTCGCAAAATAAACTACATGCCCACTTCACAAAGCGGAGGTAACATCGGCCTGATACTAAGTTGTTTTGAGTACTATAAGT
GTTTGTCTTTGGTACTGACATCAATCCCCCCCAATGAAAAATGGGAAATGCCTAAAAGTACCTAAACTTAGAACAGCAAAACACTACGTTTACTACCTAA
ATCGTGAATATAAATGCTACCTACAGTAATTTACGGCACCGCCGTAATTTACGTTTAGGCACTTTTAGGTACCATTTGAGGCAAAAATATACGACGCCGG
ATTT