Description :
From Genome Similarity Track
Location :
Scaffold_3:45514- 47515
Sequence
2001 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCAAAACCCTTCACGCCCAGGTCCACATGGACCTTAGGCACCGTGACACGAGTGCCCGTCGCGAGACGAACAGTGACGATGTCAC
TCCCGCGCGCTACCAGCGCCTCAGCATAAAGCTGACTTCCGTCCATCGTAGAACGCCGGGCGTAGTTACCCGACGCTCCCGAATCGATCAAAATCGTCCA
TGGCTTCGTGAAGCCCTTCACCCAAGCTTGGACAACTAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAGAGAGCCGTACTCTCTTCGGGGCTAAGTCC
TGTCGACCTCCACCTCGCCGAGGCTCAATAGAGCTTAGTTCTTCCCCAGTAGGCCGCCCGCGCCTACTGGGACTTCTCGTTTCCCCGAGACAAACCAGAG
CCCTGGCTCGAACTCGAAGAGCGGCTTGACGAAGCCTGGCGCTGATGGCGCAGCGGACACCCAGCACGAAGGTGACGGATGTCACCACAGATGAAGCATC
TACAGATACCGCAACGCTGCTCAGCAACACGAAGCCCGGCTTCTTCGTCTTCAGCATAGCTGAGGTCCATGGGTTCCGGACTACTCGACACGCTAGCGTG
AGACGCATTCCACCCAAGTCTCGACGACTTAAAGTTTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGAGTTCAAGTCTCACAGCTGTCGA
T