Description :
From Genome Similarity Track
Location :
contig_166:4551- 6995
Transcript NameFunction/comments
g13995.t1hypothetical protein

Sequence
2444 bases(100 bases per row)
CATACCGCAGTAGTGCTTCCGGAAATGCTGCTGAGACGACACATCAGAAGCCGGATGTGAGAGGCTCTGATGAGATCGTCGCGGCACAATTGCAAGCTAC
TTTGCAGGCATTTGCTGCTGACAGAGTTTCGAAGAACCTGATGGGAAAAACCGTGAAGATTTCTGAGCCTATTGTGAACGTGAAAGCGGAACCCGTTTCT
GAAAGTAGAACTTTTGCAATGGGAAAGGCCGAGTTGTCCTCTGGAACCAAGTCAACTGCACCTGGAAAGTCTGTCAAACGGCACATGTCCGAAAAATCTG
GTTCGTCCAAGAAAAGTTCGACTTCCGGAAAGGGGAAGAGGACGAAGTAGTCATCTGGAAAGTCAAGTGATCCTTCGGATTCGGATCCAAGTTCTGAGTG
ACTCGTACTCGGACAGTTCAAATAGCAGCTCTTTCGAGGATGTCGTTCCGAATGTCCATACGACATCGGGTCCAGGCGGATCTCTGTTTACGTTCAGGCC
GTACGTGAATGCCAGCACGTTGGAAGACTTCAATGAGAAGACGTCACTAGCTACCCGTATCCGGTGGTTGGAACGATTCCAGAGTTTTGCCGTTCAGGGT
GGTTGGTCGGATAAGGTCAAGATCTATGAGATGAAGCTGAAGTTACCTGCTGCCGTTCGAAACTGGCGTTCGAACTTGAATCCCAACGTGCGCCGGAAAT
GGAAGAAGTTCCTGAAGGAGTTCCGTGATATGTATTGCAAGGCCAAGACCTCGGATTCAGAACGTTATTACACGATGATCCAAAAGAAGGCAGAAACTCC
GCTGGAATTTTACTACCGCCTGAACAAGGTGGCCGACAAAGCTGGGATCGAGTTCGACGCATCGAGTAAGCAACGTGAGCGCCATCTGAAAGTGTTCACG
AAGAAACGTCTGGACTCTCACCTCCGAACGACTTTACAAGGACAACGTCTGCGTCGTCTGAAGGATTTGGAATATGTCCTGAAGCAGCATGAAGAAATGA
ATCAAGACGACGATTACGATACTCCACCTCCGAAGAGAGACTTCCGAGCGGACAATGTCCCTCGTGATCGATTCAGACCGAAACGTTCTGGAAGAGCCTA
CGTCCTTCATGATGACGATAACCGGGATGGCGAGCACGACAGACAAGTCCATTTTTTGGAAGAAGTGGAAGAAGTGACAAGTCGAGATCATGCTCCTAGT
GTGCTGACTACTCCAGCTGCGGATGTCACGAACGTGTCCGGTTCGAGCATGGATAACCTTTCCGAAGCAGTATTTCGTGCGATGGAGAATCCCAGACGAC
GGCCCCCGACTTCTGATTTCCGTTCGGATCGCCGGCGGCAATATTTTGGAAGTCCGAACGCGTCCAAGTTCTGTGACAAGTGCAAGGAGTTTGGACATCT
GACGGAGAACTGTTGGTCGGACATCGAATGGGACATCCGACGCACTTCTGCAGGACTCGTCCGTGTGCGATCTGTAACCAGTTTAACGAAGGCAAATGTG
GAGAGTGGAAGGCTTTCCAAGCGATCAAGAATCTTGCACGTCAAGGAGCACTGAAAGATCTGCCGTCTCCTATCCGGAAGCAACTTCTGGAAGGGAAGGT
GGATCCAGGGGAACAGCCGTTAAACTAGTAAGCCCGCTGGATGGGGATCCAGAACGCGACGGGCTGAAGAAACCGCCCGATATGTGTCTTCTAGTGTATG
TTGGTCCGGAGTTGAGACGCCAAAACCAAGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCCTCTTTCAGATGAACTTCGTCCTGAACG
AGTTCTATCGGAAGGTGTACGGCCGGAATACAAGATCCGGATGTACCTGTTGAATTCCGATTGGGGCCAGGCGAACGATATGGCTGGTGGGAAGATCACT
GTTCGGATGACACGAAACGGATTGCGATGGTTCACGGAGCGGTGAACAATTGTCGGACAGACATCCTTTTGGATTCTGGAGCGTCAGTAAGCATGGTGAG
TTTGGATCTTGCGCGTAGACTCAAACTCAAGTTAAGCTTCTGCAAACAGCTCCGGGTATCTGGACGGTGGCGTTCCGACCATCATCACCGCGAGTGCTGA
AGTGAAAATCACTTTGGGTCCGAGAATTGTGTATGTCTTGGAACTTGGGTCGCGAACATTGGTGAAGGTGTCGACGTGTTGCTTGGAATGAATTTCATGT
ATTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATCAGGACGTGGTGCGGATCATTACCACAG
AGGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGTCCAGGTGAACATGCTATCGTCCGGATACATTACGGACAGAGCAATCCACAACGT
GATGTGGTATGGGCTGGTCGGGGAGACCGATGGGTAACCCAGAT