Description :
From Genome Similarity Track
Location :
Scaffold_3:455042- 456844
Transcript NameFunction/comments
Phyca_LT1534539322PREDICTED: disks large homolog 1 isoform X9

Sequence
1802 bases(100 bases per row)
ccgaaagccaccaaacctctcgatctgatggctgcgattcgagctcgaaagcctgcgcagtccaacagtgaagagcggtaggaaagtgatgctgaatcca
agttgtcttcactcaatgtcacttgacttggcttatttaactccgttactgaacgataaagcacatatccacaggcttcggcgaacgcttcaacagctcc
atagtctctccaagccttaagttgcgtgtagattggttgttgaacgacaccagccagtccccaggacgcagttgtgtcaagcctggggaatagcccgagc
ctgtgagtctggacaccacaatctgaccgttcttccgcttaaaagtgatgccaagagggccatcactccaacgcacccacagctccggcaagggaagttg
attagcaggcgcagaactgggaattgatccacctgaaggatgtcgctggtgacgtactaccagtcccgagtcgtcgatatccgagtaagtactcaccatc
gtagcgcttccgctctggaacatgttgcgttccctctcggactcgatatattggcgacgtagctcttgtagtcgactgggctgacctagcaatgaaggag
tctcttctaaaggagctggggcttcagcatacatcggaggaggaggcaacgggccatcaccgtgagcttcgaacggtggaggacgttccacgtgatctcc
aaagtaatcatcacctgcggattcgtcgtcagggatgttgtggaggtccatactacgagcagaaggaggcaccagtgtgatcgggtctttcgcgcgccca
gaagccgtaaaaacgtccatgtaggaaggaggtggcggtagtcctgtgagtgacgggctttcatcacgagcctccggtgggaaactatcttcctctggat
agtcttcgttggacggaggttctgcaccagggaaaggtggaggagggaggtccgtgtacgtgggtagtccgttatccatgtccacattcaacgcgtggcc
actggcaggtgagtctcctagataatcgtaactctgtagacttgtgccatcatctgactctgcgtagttctctccatcttggtatccaacgccaaactgc
ttcaacgacccccctcggctcttcgatcttgatcgtcctggactgctgtatccgccactgaatgatcgtgagatgggtggccgtccagctgcggcagcgg
ctgcagctgcttcctcttcacgtagttgtctgaacgaaggcactgcagatgacgacggcaacggagcgggaactggaggcgctggcgacggcaaaccagg
atgtctcccacgtgaatttgtgcgcgagtgtccacgtccacgcctttgaaacaccaggatgacgggtttttgaactgttttaagcagttcaaaagctcca
gcgattcccaaagaatccacgtcgactccagctacacgcacgaaaatgtctcctggcttcaccgtctcgttaacgttcggcgagcctgcacctgtaagtc
gcgccaccacaactcgccctttactggacgttcggatctgaatacccaacggaccgtcgcgccacagcaccgtgtactgtctagggtccaatggagcagc
atcgtctccttctaacggcgggaaagcgtcctgacggttgctctgagggcctctatagctcggtgggagatcgttaaagctgttcccggtcggtaacggt
gcttgtcgtgccccacctcggtggaatctcaaataaactggcttggtcgcgcgcatcatgagcgtcactgtgctcttaaaaccgatctcctcggtacgca
ag