Description :
From Genome Similarity Track
Location :
Scaffold_938:455- 7418
Sequence
6963 bases(100 bases per row)
CATCAGCGATCCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATTCCCTTCCTAC
TCTTCTTCATAAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCTCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTA
CCCAACTGGGTTCGTCATATCCACGCCAGTACACCAGAAATTCGCGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTC
GACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCAAAATCCACCCGGTCGGACTCATTCACTGAAAGACGG
ATCTCAGGCCTGTGCTGATATTACCTGACCCGTTTCAGCTTGAATACGTGTACTACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTAACGG
CGTGTTCCCCTATCTTTTCGCTCACCCGGAACGGTCCGTGCCATGGATGGGCCAGTTTACGGGCGTACCTTCCTTCACCCGATCTAAATAAAGCCACACC
TGCGATCCCACTTGGATTTGATGGGGACGAGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTTCGTAGCCGTTCGTTCACTTGGGATCTGG
CTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGCAATGGCCGCTTCTAGGGTAGATTT
AGGATTCCACCCATTTACCAAGTAAAATGGGGTGTCACCCCGGATCCTTTCCTGTGCGATATTCATTGCGGAGGTGAGTCGCTCTGCGTATTCATCCCAA
TCCCTCTGACCCAAGTCTTGAACATACATCTTGAGCGCCTTAGTGATCGTCTGTACCATGCGCTCGGCTGATCCATTGGCTTGGGGACGATATGCCATGG
TTGCTCGCTGTCTTTGCCCCAGGATCCGGTTGAAGGCTCGAAAGAAATCGGACATAAAGCCTGGCTCCCGATCATGCCGAATCAACTCACTAGCCCCAAA
TCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAG
ATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGATAAGTCGCTTGGACATTCCCAGGTG
ACTCCCATTCGGTTGTGGGCCTGCCCTTGCCTGTCTGACAATCCACACATTCACCGATATATCGTTGTACGCTCTTGAATATCCCCTCCAGTGGAACCAT
TCCCGGATCCGTTGGTAGGTCCGACCAATTCCCTGATGTCCACCTTCTAAAGTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCATCA
CCAGTCTCATCAATCCATCCCGATCCTCGTTGACCCTTTTCGTAGGGGGACAATAGAAGAGCAAATCATTCAGGACTACTGCATAATCCGTAGCGATAAT
ACTGTAGGATTTGGCATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGAAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTCTGAGGATCCGCTCG
ATGCAGACTCCCTTCACAAACGCTTCCTCTAGGATCTTGGGGCTGGATCCAACCTTTCCTCTGGATCTAGTGACATCCATAGCCTGTACCGTCCGCTTCA
CGGATCCAGCCACCATAACTTCGTCTAGTCGGTTTAGTGTGACGAGACCCTGACGCTCGGCCTCTCTCTCCACCTCAACCCCACATTGATTCCGTAAAGC
AGCACTGGCCAAACTATCTGCACTGGCATTCCAATCCCGCTTGACATGCACCAACTCGTGATTCATCCAACCACACAGGTGGACCATCACTTTCTGCCAT
AACAGTGTTAGGGCCGGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCCTGT
CCCTTTAGTAGATCCAAACCCAGCAGGAGTCCGCTATACTCCGCTTCATTGACGGTGAGGCCCTCCGCACAAGTGGATCTGGCCCTTACCGCTTCCCATC
CGGGCAATTTCCACAGTATGGCGCTGTATGCTCCTCCTCCGCGTCGTATGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTTATCCACTCGTAC
CGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCGTCCATCTTGGCTCTAGGTGTGATACTCGCGGCC
AAAACTCCCAGGATCTCGTCCTCCCCCTTCGAACATTTCACAATCTCCAGTGTCCAAGGGGAGGGTAGCGCTGCCCATTGTCCCAACCGTCCTTGTAGAC
CGGCCGACTTGAACAGCCAAGCGAGCGTAGAGTGTCGAGTCAAGATCCGGATGGATCTTCCCACCAGCAGGTTATAATTGAGATCCAACATCCGTAGGGG
TGCGAATATTATCTTCTCCACCGCTCCGTAATGCATCTCATTCGGCTTTAGCGTTCGGCTGACGAAGGTGACCGGATGGCAGATCCCCTCATGTTCTTGT
ACCAAAGCTGACGAGAGCGCCCAATCACTAGCATAGACTATCATCGTAGGGTGACGCTCCGGATCAAAATGGCGGAGGATGGGCGTCGACGCGATCCTGT
TCCTTAACCCCACGAACGCGTGCTGAGCTCGGATCCACCGAGGCCCCACCTTTTTCGAGCTCCCCTCCGTCAGCTTCCTCCAGATTGGACCCTCTCCCCG
TTGGTCCCGGGATGGATCCAGCTCCTGTTTTAGGTAGTCTTCCGGCGTCGTACTACGTGAGTCCCCTCGTGGATCTGGGATCGCTAGGACCAGAGCTTGT
TGAATCTTGATCCGGACAGCCGAAGTGGCCATCGCAGCAAAATCCACCCCCCTCAACTCATAGAGGACCGCAGCAAAAGTGCATTATCCTCAATGAACCG
ACTGTAGTAGTTCGAGCTGCCCAAGAAGGATTGCATCGCCCGGAACGACTGTGAGAAAGCCACGTCTGCCAACGAAGACAGGTCTTTAGGATTCGCCTCC
AATACCTCCTTGGAGACTCGATGACCTAAGTAATTCACCTTGCGCATCCCCCAATAACTCTTCACCACGCTGATAGAGATATTCCACTTCGTACACGCCT
CCAGTAGGGATGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCTGGATTATGATGCGTTGATATAGGATCTGCGTCCTAACACAGATGGAGTCCTA
GAATCCCCTGGATCTCCTGATTCGAATGGGTCCACTTCCGTATGACCTTCCCCGGATCCATCCCCTTCGGATTCCGGTATTCGGGTAAATCCGTAGAGGG
CGTTATCGATCAGGCGTTGGTAGATTTGGGGTGCATTCTTCAATCCAAACGGCATCCGGCTCCATTCGAACAGTCCAAATGGTGTGATAAATGCGGATAT
TGCGCGAGCCCAATCCGTCATAGTCACCACCCAAAACCCGCTTGCCATATCTAGACAACCGTACCAGAGTACTTTATCCAAATCTTCCAATACCTCATGG
ATTAGAGGCATCGGAAACACCATCAATCTGGTTAGACCGTTAGCCATCCGGTAGTCAATACACAGGCGTATATCCACTCCGTTCTTCTTAACGATGTCCA
ACACAGGAGATGCCCACGCGGACGTTGAGAAACTGATGATTTGGCTTGCAGCAGACCCTTAATCAGATCCGATAGCTTTTCTCGGAACTGAGGTGCCACC
TTCCGCACCCTTTGAGCGATCGGCTTCGCGTCACCGACATCGATGTCACATTTGACTCCGCGTGCAGCTGGTGGTAATGCATTCCCTTTAACAATTAGCA
AACGTCGGCTTTCCCTGATCTTCTGACGTAGCCGATCCATTTCCGCGGGCTCGTTCGCCCCTGGATCCACTTGGATATCATCAACCGTGACCTCCTCTGT
GGTCCGCGGTACCTCCAGGATTACCGCCATACCTACTCCAAGATCTTCGGCGTGTAGATCCCCGCCTTCATGGTAGCAGACTTGTTCATCGTCAGTCTTT
GTCGGATCCACCACTGGATCCAAGCACCGCGACTCCCCTTCTCCCGTCATTTCTTCTGTTTTCATGGGATCGGGAATCCTGGTACCGGGAAAACTACCTT
TTGGATCGACTTGATCCTCTGGTGAGTTTACCCACGACGGTTCCTGTTTACCCCGGTGCTGACACTCTCGACAAGGATCCAGGCACTCTGTCCAATGAAA
AGCTTGGGTCCAACTGTGGGTCAGCAGGATCCAGCGGACCGGTTTTAATTCCCTGCGATCCCCCATCCACAGACCCTTGGTTACCTAGGGACCGGCTCTG
GGTATCACCAGCGGTCTTGGATCCAGCCTCTACCACTTGGATCCCAATCCGACGATCCCTATGTAGGATCATTCGCGGAGATGGGTATGAAGGCGGATCC
ACCAAAGGGCCAGTTGGCTCCGCCGGGAGTTCCGCCTCCCCGAGAGATTCAGGCTCGGTTGTCGCTTCATACGCCAGATTCCGCCATTCTCTATAGCAAC
GGGACCCCACTGACACATATCCAGGTCGCCTAGGGATACCATCCTTCGCCAACCATCGTCCAATCTCCTCATAGTGGTCCAGTAATAGTCTCTTGTCGCT
GACATTCGTGACTTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACTCTAGGCACCCACTTCTCACCCCGAGTACCCACCGTTTCTCATGTTCTACCC
ACTTCAACCGATGTGGCAGATCACAGGTCTCTCCGGGCTCGATCCAGGTCGTCTTATTCGCCCTTATGATCATCATCGTCGCCCCGTACAACGGTCGTCG
TCCACTGAGCTGGATCCGCATCTCGTCCGGGAAGCACGGTGTCCCATCTGCCAGATCCAACCTTACTCCGGCTGGTATCATGAAATCCATCCCGAGGATG
GCGTCTTGACCAGCGAGGTCTCCGACCCAAATGTCGAACCAGTATACCAAACAACCTGCCAGCGTGATCTTGATCCGTGTTCTCCCATTCGTACGGTACA
CCCCTTAACCAATCCCAGCACAATCTCGGATCCGACTCCCATCCACTTGGCACCCAACTTACGAGAAAAGGCGGTATCTAGTATAGACACCTCGGCACCA
CTATCTAGGGGTAGGTTCGCTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGA
CTCCCCTGTCAGCAGATCCATGGATCCACCATCTTCAGATCCCCGGGATCCAGTAACCTGACAAACCTTGGGTGGATCTGCAGTGACCTCACCCTTGGTA
GGCTCAACCCATCGACCATGTTGTCGCGTCTCCCAGTAACCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCAT
CCACTTGGCGCAAACTAGTAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTTCTGCTACCTGGATCTAGCGATGT
CTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTATTGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTG
GCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCTGACGTCGTGAATCTCGCCACACCC
GCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTTTTTAGCATCCAGATTCAGTGTGCTTCCGGG
ATCCGCACTGTGAACACCTGATTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTT
GTCTTCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCT
GAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGC
GGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATTCACGTCTCCCAA
CGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGG
TATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGGACTGGGTCTATAACTGCGCAGCAA
ATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTAAGCATCC
GACGCTTGGTCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATA
TGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATC
TGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCC