Description :
From Genome Similarity Track
Location :
Scaffold_583:455- 3824
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_583-fgenesh-gene-0.3Rab6 family GTPase

Sequence
3369 bases(100 bases per row)
TGCTAACGGGTGATATGATGAATTGTTAGATCGTTCCACGTTCCTAAGCACATCCAAGTGGGTTGAAGCTGTGCGAACGGAGCGCAGGGACGACGTCGTG
ATCATGTTGGTCGCGAACAAGTCAGATCTTTCGGACGAGCAACGGCAGGTGCTCATTGACGAAGGCGTGAACAAGGCGAAAGAGGAAAACGTGCTGTTCA
TCGAGACAAGTGCGAAGGCCAAGGAGAACGTCCAAGCGCTATTCGAAAAGCTCGCGACCGTGGTACCCAGCGTGGAGACCACAGGTTCCACCTGTACGTC
GTTCTTTTTGTTTGCCTGATCCATGTTGCAAAGCTCATTTCGTATATGCTTCTTTTTTACGAACGTGTGAATAGGTTGACACGGCAGCGCCTTATCCGAA
AGAAGGGACCGTCGATTTCTGCCTGTAGTGGTGGATCGAATGAGCAAATATCAAGACAGCTTTTCCAAGTACGTCATGGAAAGCAGCAAAAGTCAAGATG
AAAAACAAACAGCCATCGGAGAAGCAAAAGACTAGGAGGATTTATGTGCTTCTTGTGCGTCACTTTGTTCTTTTGTAGATACAACTAAGGCGTGATGTGC
TGTTTGCTGCCCTCGCTACTTGCTTTGTCATCTATCACAGACACTTCCCCGCTCATGTTTGCACTCGATTCCTGTTTTTTTCACTTCGAGAATGCCTCTT
GAACGATCGATCCGCTTGGCGTTTGGCAAAAAACGTTTAATTGATTCCTGCAATTGTTGCCGCTTGAAAAAGGGTCCAGATAAGTTTTCCTCACAGCGGA
AAACGTTGGCCGTGGGGTAGATGATTGTCATATTGGGATTCAACTAGAGCCGCCAATGGTCGAGGACGTTTTCAAAAAAGCAATTCGATCGAGGTCTTAG
TTTGAGTGTTTAGCCTGGAAATCGGCGAAAAGCGGCGATCACTCATGTCGTGCGCGCATTCTGTACCACCAAGTTCACTTGCGCCTAGAGCGTATTGTAT
CCATCCGAATGACCTGGCAAATGCAAAACTAAAGAGATCACAATCAAGGACAGCTTGCGATGGTTGGTGACTCCATGCCGCTTCGACAATTTCGAGCAAA
TGAGCGAGTCGACACAACTGCCAGCTGCTATGCGGGTATTGAGCTCCAAATCGTTTCGCCTTCCTGTCAGGACTCGGCGTAAAGTGGAAGGCAGTATCGG
TGCCCAACGACCGACCATGCGCTTCAGGAGAATTGCAAATCCGGGAATATGAAGCTGCGTAAGTTGCACAAACGCACATGCAGGGCAAATGGCAGTCGCG
TTCGTCCGCGTCGCTTGAAGAGAGCGAGTTGAGGCGAGTGTTCCAGTTCTGAAAGTTTCCTGTAGGAACATAAAACGTCACATCATTGTGCGCGCTCGCG
GTCAGCGTTCGACACCATGCACAATACTATTCGTGTGTCGCTTTCGTTCGTCGCCACGTGTGGTAAACGCGCGCTGCTGCTCGACAAACTCGTCTAGTGA
ACGCGCTTTACGGTGTGAGAGCTGCCACGTTCGTGTGAGCGCATGTGCTGCCGTCATTCGTCGACTGAAACCTCCAATTCGGCCTCTTCCTATGGTGAGT
GATCGGCAAGAGAGGATTTCCCCAATTGGCCTCGCAAGCTTTTGGTCCGTGCTCGCCACACAACAGAGCACAAAAGTAAGCGAGCAAACCAAAACTCCAG
AACGTTCGTTTGGTGAGATTCGCAAATGTGCCACGAAAAACCGCGAAATTGTCACGACTAAAAATCGTGATTTCGACAAATTTTACGGTTATCACGAAAT
CGTCGCCGTCGACGGTGCCTCGCTCCCTCTTGTCGATCCAGTTTGAGGGAGGCATCAGAAAAAAGAGGGATGGCTCGTCATCCTCTGTTTGCTGCATTCA
GGACGACGACGCGAACGAGAGCATTTTCCCTCTCGCTCGTGACAAAGCAGGCAGGTTGTTCCACTCCCTATGGCTCGTCATGCCGCTCAGACACCCAGCA
AACGGGCCACGCATTTCGGCTGGTCAGTGCACAGCGGCCAATGAAAATGCAGTGTCTGGGCCAAGATTCATGATCCCAAATCGTGCAACCTGCATGTGTA
CATGCCTGCGAGTCTGCCATTCAAAGTGCCCACGATCAACTGCCAGCGATTGCATCATTATTGCATCGCGCACACAACTGCATAGCTATACTTGCAAACA
CGCGTTGTATCTGCTGATCATCACACACACGCACACAGCTGCAACTTGTCTCCATTGCTATTGAATCAAAGAGCGCTCATACACCACAGACATGACAATG
TTACTCACCTGTTGGCCGCAAAGAGCTGACAACTTAAAGGCTGCAAATCGCACCAGCATTACACATAGAGCGCAGCATCCGGACGAATCTTCGCGCCCAT
AGAAACTTGTTGGTGACGCATGCGAAACTGTATGTGGCGCTGGCGGCGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATC
GGCATCTTGTCATTGCTGCAAAATCGAATCTTCAACAACCGAGCGGCCTGATTTTGTACGGAGACAAGTAAGTCACCACTTTCAACTAAGTCGTCAAAGA
TTTTAAAGTCAACAACAGCATGCTTTTTGCGCAAAACACAGCTCACGTTTGGCAAATCGATGGAGAAAAAACAGATAAACTCACTATTGTTGCACGATGA
GAGCGTTTCGCAGATGGTCTGCGTTGCCACGAAAAGCGAGATGTGCTCATGGGCCGAGAGATGACTGGTTGAGACGGCGCAGCATTTGTAGATCTTGCAC
TGACGCACCTGGTCGGTGACGCCTTCAGATGTGACTGGCTGCGGTGCAATTTGTGCACGTGTCCATTTGCATGACATGCGCGATCAGTGAATGCCGACGC
ATGTGAATGTCGTGTAATCGCATTGTTTCAGTGATCTGCACGTGCAGATAGATGTACCGTCAATTGTCAGCGCTGCAGCTCTCACCCAGCAAACATGCAC
CATGCACCATGCACCCAGTGACCGAAAACAAGCAGATCGGTGGCGTTGGCTACTTAGTGGCAAATGTCAACTTGTGGACCCAACCTCTGAAACTTGATGC
ATCTTGCAGAAAAAGAACTCACTCAATATGCAGAACTACCAAACAGCCTGAAATGATGAGTCGCCACATTCGAGGATGAGTGGACGGTATTTTGCATGTG
ATTGCGCCTTGGCGCATGCACTAAATCATGTTCCCTGCGGTTTAGTTCAGATGGACGAAGCACATTGGGATGAACGGCGTACACACATACACATACAACG
TACACACAGCATTCCGTAGAGCTAATCGCCCACGAGACAAGCGACCGCCGTTTAACGGAGAATCTGAAT