Description :
From Genome Similarity Track
Location :
Scaffold_2042:455- 3212
Sequence
2757 bases(100 bases per row)
GGCCAAAAGCCGATTCCAGATTCCAGTTCCCCGACGTTACAGGGTGAATGAGAATCTATACGTCCTGAATTTTCGATAGATACCGCTCGTGTACGAACGC
GGGGGGAGGGGCCTCACAGTGCAATACTTTGGAGATTTTCCCGCCGGGGTGGTAATTTGTACGGCCCAGATCCACTTACGCGGAAGGCCTCACCGTCAAT
GAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAGCGGCTGGTAATTTGTGGGGATTCAAATTTGGTAATCAGAC
AGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGGATCACGAGTTGGTGCA
TGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGAGAGAGGCCCGAGCATCATGA
TCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCGGTCACTAGGTCCAGAGGAAGGATTGGA
TCCAGCCCCCAGATTCTCGAGGAAACATTTGTGAGGGGAGTCCGCATTGAGCGGATCCGCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGA
AGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATGCCAAATCCTACAGTATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTT
CTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATGAC
GCTAGTTTAGAAGGTGGACATCAGGGTATCGGTCGGACATACCAACGGATCCGGGAATGTTTCCACTGGAGGGGACTATTCAAGAGCGTACAACGATATG
TCGGTGAATGTGTGGATTGTGAAACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTTATCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGC
CATGGATCATATCCCCTCGTTGCCCAAATCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATCTGTTTACCGGATACGTGATAGCCAAAGCTAGT
GCGTCTAGAACTGCGCAAACCATTGCCGAGTCGTACGAGGAGTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGATTAGACATGATCGGGAGCCAGGCT
TTATGTCGGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGGGCAACCATGTCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCAT
GGTGCAGACGATCACGAGGGCACTTAAGATGTATGTCCAGGATTTGGATCAGAGGGACTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATGAACACC
GCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACAAGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCAGTATGTAGCTCCAAGA
AGAGAAACCGAGATCCAAGGCGATGGCGATATTAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAAAA
TCGAGCGGATCGACATAACGAAGACGCCCGTCCGCATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGC
AAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAAAAGATAGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCTTGTTCC
CTGTAGTACACGTATCCAAGCTGAAGCTGGTCAAAGAATATCCAGATCGGCCGCAAACCCGTCTTTCGGTGGATGGATCCGACCGGGTAGACTTCGACGA
TGTCCTCCTACCGGAAGATAGTTGGAATGTGGACCTCGAGGCCGACGAGTTCGAAGTCGAGAAGATCACTGACATGAGGTCAGGGAAGCGAACTAGATAC
GGACGGATTACCGTGCATTTCTGGTGCATTGGCGTGGATATGACGAACCCAGTTGGGAAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTT
GTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAGGGGATCCATGGATGTGAGTTGGTCATGTCGATGGG
AGGATGAAGAAGGATTCACAGGATGGGTGTGGGTTGGGGGAAGGAGGACCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGG
AGAAGGGTGAATTAGGAGGAAGGAGTGAATGTTTATGCATAAGGAGTGACGTTTTACGTGCGAAGAGTCCTGCTTGATTTCAAGCGCGAGCTTTCAAGGG
CCCGAGCTATATTGACCCAATTGAAACTGGGTCATTGGCGCTAGATCCGGATGAAATCCAGGCGCAGACCCAGCCCAGATCCAGGTGTACGCTGAAAGGG
TGGATCCAGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCTAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACGC
TGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCAGCCCA