Description :
From Genome Similarity Track
Location :
Scaffold_2398:455- 3045
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2398-snap-gene-0.4Serine protease family S01A
Pytiw_DAOMBR242034maker-piw_contig_2398-fgenesh-gene-0.0Oligopeptidase A

Sequence
2590 bases(100 bases per row)
CGTGGCGCCGTCGGCCGTCTTGCGCAGACTCACAATGTACTTGTATAGCGACGCGTCGGCCTCCGTGCCGCCGTAGATGCGCTGCTCGTCGTTCGCGTCA
TCGTCACTGGCGCTCGTGCTGGTGGTGGTGGCGTCGCCCGAGCGGTCGAGCTCGTCCGTGAAGTCCCACGCGCGGACGCTGGCCGAGAGCGCGGCCATGA
GGCCGAGGCTGAGGATCGCGTTCACCTTCATGCTGCTAGTGTGTGTGTGTGGAGAGATGCGCTCGTGGCGAATAAGAGGAGAAGGCTTCTACGGGGAGAA
TTCAGCACTGGCGATACAAATGGTCACGAATGAATAGGAATGGGGAATATGCAGACCAACAACACATGTGAGCCAGCAGATGGTCTCGGAGCGGTTTCCA
CGAGATAAAACTGAATCGAAAAACTCATTTCGGAGAGGTTCGCAGGGTCGTCGTACCGGATATATAAAGGTTTTGATGTATTTGAGAATTAACTTTGTAA
TATATTGGATTATTACTTTGTTGGAGTATAATTTAAGGGTATAAACAGGTTTATCGTAGTATAAAGAGGTGCGAACCGAAATCTACTGGCTCTTTGCCAG
CTGGAACGTGGGAAGCGCGATGTTGAAACTGTTGAGTCGCGATCCTGGTTTTACATGCTGGACGCATCGAACGAAAGCAGCACATGCATATTGGGCCAGT
GTCCTGTTGATCAGGCTGAGACGGCGGACTGGACGATGAGGCAGCTGAGCCATTGGGCCATCCACTCCTCGCGTGCACGCACCGCATGACTATGGATGCA
GTGTCACGGCTTGGATAGTCGGTGATTGTTTGACGTTGCTCTCGACAGGCCGCCGGCTGCTGGCTCTGCTGCTATCGTATCGTGTCGGGTGTTGGGGAGA
AGGGCCAGGAGCTAAATCAAACAAAGCCAGAGAGGTTGGCTCGATGTTCACGTGATGGAGAGGAAGGCAGTGGCCAAATCCCGGTGAATGGCTCTCGGAT
GAGGTTGTGAATCGTATCCGACTCGTGGGTGAGCTCCTCGACTCGGGGTGCGTTAGCCAGAAAGCCTCGGATCGAGGGCCCAGGCTAACGCACCAGTTGG
AGCTGCTCGCGGAGAACGATGCCACCGACAAGCTGCTTGGTTGTCACCCGAAGAGTAATCCGAGCGCAGCACTCTGTCGTGTGCGTACAGTGTCCACATT
TGTCCACATTGTACTCTTCAAGGTTATGTCCACATGAGCTTGCGACCTCGTCTCAACCCTTTCATTTAATAAAACGAGTACTGTACGAATTCTATAATAT
AATATTTCGAGGATCGGTGTACAGTCCGAATTCTTTAAAATAGTAAGAACCTTCGATGACAACCGAAATCCCAATTCTGCGGTCATCATGCTCCGCCAAT
CGCTCCGCGCCGTCCGTGCGCTGCACGTGCAGCGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCTCTGCGCTCTTCGTGCGCTCACTGGCGACCGCAGTCGCCAACCCGCTGCTCGAGTGCGTGCGCGAGCGCCAGCTGC
CGCCCTTCGAGCGGCTCCAGATCGCCGACATTGAGCCGGCGGTGCAGGCCGCCGCGAGCGAATACACACGCGAGCTGCGCGCCCTGGAGCAGAGTCTCGA
GACGAGTCGCGCGCAGCTGCAATGGCGCGACGTCGTGGACCCGCTGGAGGTGCAGAGCGACCCACTCGGACGCATCTGGGGCATCGTGGGCCATCTCATG
AGCGTGCGCAACTCCGAGGAGCTACGCGCAGTGCACGACCAGCTGCAGCAGCTCGTGATCAAGACGTTCACCGAGGCGTCACAAAGCAAAGTGCTCTTCC
ACGCCTACCAGGCCGTGCGCGACAGCGCCGAGTGGGACTCGCTCTCACTGGCGCAGAAGGTGTGTAAAGCTTGCTTTAGGCTGTGGTGATCGGCCAGTTA
CCTATATTAACGCTGCGTTATTGTTTTCTTTGCAGCGAATCATTGAGTTGAGCCTCCGCAGTGCATCGCTGAGCGGCGTGGGCCTCGAAGGCGAAGAGAA
GGAGCGCTTCAACAAGCTCAAGCTACGCGCTGCCGAGTTGGTAAGCTGGAATAGTGCTTAATATCTAAAACGTGTGGCTGTGGAGGCAAGTTAACACCAT
CGTGTGTTGTTAATGTGCCGAACAGAGCACCAAGTTCGCGTCCAACCTGATGGACGCCACCAAGGCGTTTTCGGTCATCGTGACGAACAAATCCGAGCTT
GAAGGGCTCCCGGACTCGCTCCTGCAGCTCTTCTCCCAGGTACCATCGTAACGACCCCCGTCCATTCATTTCCCACAGCCTAAACAAAACTATCTATGTA
TTTAATATGTAGAGCGCTCGCGAAGAAGGCCACGAGGCCTCCACGGCCGCCGCTGGCCCGTGGCGCATCACGCTCGACCCGCCGTCGTAC