Description :
From Genome Similarity Track
Location :
Scaffold_5:455- 1918
Transcript NameFunction/comments
Phymu_g361hypothetical protein PHYSODRAFT_317222

Sequence
1463 bases(100 bases per row)
TTGTCCTCCGAATCAAGCGACGATGACACGAGCAATGAGACTGCGGAGGTTCCTAAGGAAAGCGTTAGCAGTAGCGAAGAAGAGTGGTCGGAGGGCGATA
CACGAGGCGGGTTTgaccaggaagaggatgaagacgacgaggaaaCGGGGGAGGACTCGTCATCACCTTcagagaaggaggacgcagAGGACTCAGAGGA
GGATTTGAAACTGGTTGCGAGTAGTCAAATCGGACAGAATGGCAAGGCTCGTTCGGCTGCAGAGTTTCAAGAAGACAAACGGAAGGTAAATGGGGAAGTC
AAGGCCAAGCTTGAAGGTGAAGGTGAGGGCACTTCTGGCGATAGTGACGTGGAGAAATACGATCAGAACCACAAGGGTCCACGGCCACTTTTGACGACGT
CTCAGAGGAAGCGCAACGGGGTGATGCACGCGTCAAAGAGAAGTCGTATGCACAATACTGAAAAGAACTCAACGGGACATCGCAATGCAAGTTCACACCA
TGGCAAGCATAAATATTCTGGGCCAACCAAAGGGAAAAGCCGACAAGTTGCCAAGAAAGCGAGGTCTGCACCAAGAAATTTGCTGGAGAACACCAACACC
ACTGCTCATGGTGGAGACTGGGGAGATAACGAGgacaacagcttcgacttgggGGTCGACCAGTATGGCGAGTCCCCGCCACGCCGGCCACCGTCAAGGG
CACACTCCCGAGCAAACAGTGTCAGGTCTTCACCTGCTACGAGTGTTGTGGCTGGCAGCCCACTGCCAGATTCTGCTGTACAACAAAAgggtgcagcttc
accagcgcGCGTGACCTCGGAAACCGCCGACTGCCGCGCTGCCCCCGCGGCATCAGCCACTCCACACCCGCCTCTCTCTTCACAaaatactgctgctgcg
agccCCAGACCAATTCCTTCTGAGAGCCAGAAAAGTGATGTTGGCGAtgcaggttcttcagcagaGATGTCTATGGAGCTAACGCAAGTGGTGCTGCCTC
CTGATCGCGAGAACAAATACCACATTCGGGTATCCGTGTCTGCGGACAAGCCACCACTTCATACGATTAGGGTGAAGAATTTGTCATcgcacgagcagcg
cgagcatAACTTTGCCGATGTCATGGAACTACCTGGTGCGGATCCGGACATTCGCGTGCCAACTCGTGCTGTCCTGACGGCGCTGTTCCGATGCCTGAGT
AGCCAGCGTGATGCTGTAGTGATCGTTGGGCCAGAGCCAAAGGCAACCGCGGAGTCGAAAACTACGTTCGAGAAGGGAGAAGTAAAGCTGGTGACGTCTA
CTGCGGAGAAGGACTCCACGGAAGCCGATGGAGGCGATGGATGGACGCTGGTCGTTGCTTACCCGAAGTTGGATCTTTTCGAAGTCCTGCACAATTTCCC
GTTGAAGTTGGTGCCCGCAGACCAGCGGCTTCAGCAACTCTCGAAGGAAGTGGAGAGTCTGAG