Description :
From Genome Similarity Track
Location :
Scaffold_754:455- 13170
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_754-abinit-gene-0.10TRNA wybutosine-synthesizing protein
Pytve_DAOMBR484maker-pve_contig_754-fgenesh-gene-0.0Anaphase-promoting complex subunit
Pytve_DAOMBR484maker-pve_contig_754-snap-gene-0.9Poly(A) polymerase

Sequence
12715 bases(100 bases per row)
CAGACCATCAAACACAAGCAACTCGATGATCTAGCTGGTGGCACTGGGAGGGACCATTTCACAGTATACGTCCGCGACGAGGTGCCACACCTTTGGTGCG
TACGACTTGACCTTCTCGACGTGTTTGCACGACACGACCCAGCGTTTGCCGATATCGAGCGCCAGCGCTTCGATGGATCGAATGACGCGCTCTTCCCACG
CCTCGCGATCTTCCACTGCCACATTGTCGTGCACATGGAGCCATCCGCCAGTAGGCTTGAGGACTTGAACGGCCAGCGGCCACGCCTTCTCGCTCGTCGG
AAGCAACCCGAGGTTGACGCGATCTGCCACTGCGCCAATCGTCGGAGCACTCTTCTGGTTGTCGCCAAAATACACCTGACACTTGTGGGCAACATGGTTG
CGTTCCAAATTGAATCGCAGCGCGGCAACCGAGTCGGGGTTCCACTCGCACGCATGAACGAACGCGGCGTTGCCGTGCACAAGGAACGGGAGCACATAGT
ACCCAATGCCGCAAAACAGGTCAACAACGACCTCGCCCTGGCAGCCGATCTTGCCCATTCGAGCCTTCTCGGTCACGTTGCCAGACGAGAACATGACGCG
CGTGAGATCCCAGCCGTAGATGATGCCGTTCTCGCGGACCTCCACCCAACCAGGCTGCTCGCGGCTTCTGGACGAGGCCAGCGCTTGCTGGTTGATGTAC
AACAGCTCCACGTGACTTTGGCGCTTCTCGCCCGAATCGATGAACGCCTTGCGCGCGACGCGAGAAAAGGGCGGTGCCGTCGACGAGCACACTTGCGACC
ACATTTCCGTGGCAAACGGCGACCACTCCGGCTCGATGAATGATTCGCGGGGGACAAGGAGCACGTCGTTAACAAACTCATAGCGATCTGGAATGGCCTC
CTGCACTGTCTTGGAGAGACCGTATTGCTGAGCAAACGCCTTGACAATACTCGTGATCACTTCGTTCCGGTTCAACCCACTGCTCTTCCCGTACTTGTTG
GCGTACGCGTCTTTATCCTCAGAAAGCACGAGTGCGCGGAGATCAGGGTCGGTTGTAGTGGCAAGGAGATCTGCAATCTGCGGTAACACTGGGATCAGAA
ACGCTGTCGGTTTCCCATCGACGGCTGCGTCGGTCACCACGTGGACTCTGCGAGTCTTGTCGTATACTTTTGCGCTTTCCAGCAGAGTCTTGATCTTCTT
CACTTGCAACTTGTCGACAATCACGCCCTGACGTTCGCCTTGCTGCTCGTCTGAAGACGCCGTAGCTGAGTAATGGGTCGTGGAATCTCCAGTTGCAATG
GCTTTAACGGGACGACCAGCACTCTGTGCTGTCCGCGGCACAGCAGAGATCGACAACTGACATCGGAATACCGATGAGTAGACTTGACCGAAACCAAAAC
ACTGGAACCCTCCCCCCAAAACATACAAACTGTTGGTTGATGGGATCCACTCGCAGGTATGGCCCACGAATGCAGCATCGTTGCTCGTCACGTTCCCCAA
GGCAGTCCATTCCAGCGAGTCCATGCTCAATGCGTAAAGTTTCTGGGATGATGACCCGCCATTTCCAGCGTCCGTCGCCCCACCAACCACCACGACAAGT
CGCTCGTTCAACGCACACGCACTCGCGCCGACAAGTGGTCGAGGGGGAGCTACAAAGCTTGGTCCGGATGTTTCGATGACTTTCCACTCTTTCGACGTCG
TGTCAAAGATAAGGCATTCCAAATGTTGGCTGTCATGGCTGCTTGTGCTGGCGCTTTCCGCCTCAAGTCCATGCAATGAGGCCACACCGCCGAGAATCAA
GAGCTTTGTCTTGTCAATGACGACACAAGTATGATCACAGCAAGGCTGTGGACTGTATCCCGAGGTTTCTGTCAAATGTCCACAGTGCACGCGCATTAAT
GCCGATAGTACAGCGACAACAAGAATGAGAATAGCGCAAACCTTACCGATTCGACGCCAGGAAAGCGGAGTTTGAACCAAGTCCAAAGCGAACAAATCAC
TCAACACTCGGTCTTGGTCACGACCACCGAAAACATACATCGTTGATCCGACTAACCATTGACGATGAAACGTGTCAGTTCCTGCACAATCCACATCATC
CAGTTCAAAGGGGACATGTCCGACGACGTACCAATACAGGCTGAATGTTTCCAGCGTGGGCTTGGACTCACGTCGCCATCCACTTGCAATTGTTCCCAAA
CCTTGGATTCCATGTCGAAAGCGTACAGATCGTTCAGTGGCCGTGTCGGTCCAGCGCGACCACCAAACACAATCATCCGCTTGCCGGACATCACTGCTGA
ATGGTACATCCTTGCTGATGGCGTCGAACCATTCGCTGAGTCGCTCGAGCTGTAGCCAAGCTTCAACTCCCCAGATTCGTCTGCCGTCAGAACTGACAGA
CTGGCAACACGAGTAGTCGTTCCAGTCGCAGTCGGTCCTTGTCCTCCAAATACAACGACGCTGTCCTCAAACCGGACCGAAGAGTGGCCGACAAGTTTCA
AGTCGGTCTCCAGCTGAGTCCAGTTGTTCAACGTCGCCTGAGAGGAAGGCGCTTCAGACAATTGCGCGCTGCCAAGGATAAACGTGCTCGAAAATGCGGC
AAACAGCTGGTCGGTTTTGCGCTTGTTGGCTCTGAATTTGTCGTTGGCGTTCTCCAGGATCCACTTCAGGTAGTCGTCGCTCACAAACAGATCATTCGGG
TGGCGTCCCAGTGGAATCTCGAGAGAGTTCGACGTCGTGCGGATCGCGCACATGATCTTCTTGTTGCCGAGCACAACGCCGGACTCGCGGAAGCCACACG
AGATCCCCCACTGCAGCAGTTTCTTGGCGGCGTCCAGGTCGCGACACACAACGTGCATGATGAACGGTTCGTGCTTGAAGATGAGCTGTCAGCAGCGCCA
CCACCACAGCATGCACCGTCATCAATATCACCAGTCACAAACAACAGAGGCATTACGATGCATACCATATTACTGGATGAGTGATCGCCAGTCTCGGCCG
ATTTCAGAGCGGCTGTTAGCTGCTCAAACGTGACGGTCGCGTGCTCCGCCAGCAGCCATGTGCCTCCCTTGGTGATCAGCGTTGAGCTGGGTGCACCGTC
GTCATGATCGCCAGACGAGCGCTTCGCCGAACCTGCCGCTGGCTCTCCGCAGAACACGGCGATCCGACCGGAACACGAGCTGCTAGTCACCTGCCACAGA
AACACCAAGTTGCTCGTCAACCTGACCGACCGAATCGGACATTTGTCAGCGCCACGTACGTAGTTTGGGTGGTCGTTGATGGCACGAATCAGGTCTACAA
TCGGCTCGTCGATGCTTCCCTTCGGACTCTTGTCCTCGAACGCGCGCAGCTTGCGCAGGCTCTCGCGCTTGAGCTGCGCGAACATGGACGCCGCTTCCAG
CTCGGAGCTGTTCCAGCTTTCGCCACCAGCCAACTCAAGGTAAACTTGCCCCAAATAAGTAACCCAAAACGCTTGTGCGTGTCAGCCCAAATTACTAGTT
TAGGATGTTGCTTTTCGTCATGACTCCCTGGTAGGCGTTGAAGAGATCCGCATGGACGAGCTGCCGGCGGTCCGCTCACTATGTGCCGGCGCGCGGCCTG
GCCCCACAGCGAACGCGCCGCAGTTCTTCTTCTTCGAGTCGGCGGGAGGCAGCTCTCCTTATGTGCTGCGCGTAAGCGAGCACTCGGTCGCGTTCGTGCA
CCGCGGGACTGACGCCGTCGAGCGGAGTTTCGTCTTCCCAGACCCGATCATTCACGCTGTGTGCGCCGATTTCCCCACCAGGAGCGACCAGAACAGGGCG
AAGACTCGGACAGACGATAGTTCAAGGCGTCCTCACCTGTGCGTGCTGGTTCGGTCGGACTGCGTCAACATCTACGCGCCGACGGGGGACGTTTACGAGG
TGGCGCTGCCTTTCCAGGCAAATCGACTGTTTCCGATGGCCGACGCGGACGGGAACGGCTTGGGGCTACTCTTGCAGCGTACCCCTGCGCCACTGCTGTT
GTCGACACCTGCCAAGAAACCGAACGCCGCGACGACGAGGACGACGGGCAACAGCAGCGGGTACAGCGACCACCGCTATGTTCCGACGTCGACGTCGACG
CACAAGGCAGGCGAGGTCGATAGCGGGATCGACATGCCACTGTTCGCACGTCCGCGATTTTTCACACTGTCACACCCACTGGATGAGATCAAGCCGATCG
CGATCGCGACAACGACCCGTCCACGAGGACGCGACTCGACCAAGGAAGAAGTGCCGCTGTTTCTGTCAGATCCGGGGTTGACGGTGGTGTCGCTACTGCA
AGAGCTCTCAGTGCTGGTCACGTTTCACGAAGATGATCAGAAATTCTGCGTGTTCCAGCTCCAGAAAAGGCAGAACCGGTCACAGAGAGCAGTGGTTCCT
CCGAAAGTGAAGCTTGTGGACGGCCCCGCGTGGACAAAATTCCGTCAAGAGATGGAGTTCCAGGAGCAGCGCATCGTCATTGAGCCCGAGTGGACGGTGC
AGGAACTGTGGAGATCGCCGAGCGTTTCGTCTCTTACTCCGGACAAGAACAAATTCGGATTGTTGCTGAGAGCGGATGAACCGTGGAGGTCGGCGTTCAT
ATCTTCTGACGGTGATGGATCGCCCTTGCTGTGTTTGATGGACAAGGTCTCCGGCGTTCTCTTGCTCGAGCATGTTTCACTTCACGAAAATGCTCTGACA
GGGCAAGTCTTGGTCGCGATCAACTCGAATGATGTTGGTGATCGCGACCAATTCGCTCGCTTCATTCGCTGTCGCGATGCAGTGCCAATCAGCTCACCGA
CGCAGACAAAGTGGAGCGAAGAGCGAGAGTCGCTTGGGGATCGGATCGGCCAACGCGATATCATTGTGCTCAAGATGGATGAAACTGTTGTGCTGTATCG
ATCTGAGCGTCCTCTGTGCCGCATCGATCTGTCATGGGGCGAGACATCCCCATCTAAGTCGCCCATGTCATCACTAAAGCCGTCGTCGTTGATTACTGCA
GAAAATGGATTTGCTTATGAAATCCTGTTTGAAGAAGCGAGCAACCTCACCTCGGCTTGGCGATGGGAGCATCCATTGCGGATGACGATGTCCCCTCTTG
TTGATCGTGCGATGAGCGTGCTCGATTACGTTCTTGCACCTATTGTGAGTAGCACGATGAAGGTGGTCATATGCTGTCGCGCTCAAGCCAAGGAGGGACG
ACAACGGGGGGATATTGCCTTCAGCGATGTCGGGTGGGGGGCATGTGTTGATCTTTTGCTTGAACTCGCCGGTGACCAAGGAATGAACAACAGCACGAGT
GAATACTCCACGACAGGTGCAACTTCATCTCTGTCGTCCTTCGATCTACTTTGCCACAGCGACTTTCACAAACGCTATCAGTATGAAAACGATATTCTAC
TATCAAGTTTGACTCTGCCGACTCCTGTTTTACCTCGACACGAAGAAGCCATCACAAACGAACTGTCAGCGGAGCAGAAAACAATACTTTCGGATCGCGT
TGGTGAGATGTTTGCTGCGCTGCATTTGCTGCATGAGGATTTGAAACTCTCTCAGTCGTCTACACAGTGGCGCCTGGAACTGTCTGGTCTTCTCAGTCGA
ATGGCTACGGGACTTGGACTGGTGCAGTTCTCCGATTATTACTCGCTCGACTCGTGTGTCTATAATCGACCCGACCTGACTGTGGCGCGATCAGCATCTC
CACCGGCAGTGCGTAGCGTTGAGTTTATGTGGCTTACGGAGAATGTTCCAGATATTTTTGCTTGGATCCAAGAACGAATTGTATGGAGTCAAGGCGACGC
CAACAGAGTGGATAATGGGTTCCCCATGCTACCTATGAAGTCCCAACCGCAAGTTAGCTCCTTGCAACGTCAGCTTCCACTCCAGAGAACTCGTGCTGTC
TGTCGTATTTACGAGATGCTGTTTCCTGTGGACTCCGATCACGATGCTGCATTGGAGTGGGGGTCGATTATGAGTCTTCTCGCTCGTAAACTCCATCGGC
GCTCATTTTCTCTTGAAGACCTACCTGTTGGTATCGCCCATCCGATTGTTCAGGCGATCCAATATGTCAAAGAAGATCCTCCACCGTCGATCGGAGAGGA
TGTGTGTGCCTTGATCGGGAGACCAGACTTAATCGGCCGCGGCACGATGAATGCAGCAACTTCCGCCACAGTCACCGCTGAAGGCGGGACAACGAGGTTT
CAGCATCAACAGATAGACGAAAATGCATCGGCTACCGAGGAAACGATCCAAGAAACAAGCGACGGTCTGGACGAAGTCGTCACCACCAGCCAGCCAATCT
TCCCGCGTGATCAGCGAGTCAAAGAAGTCGCTCGTCTGTTGCGGTCCAGTCGACCCATTTGCCTCAAATTGGAGAAAGGACCCGATGTGACTGATCAAGA
CTACGTGCAGCAGCAGCAGGCTAGGCTGTTGTTGTTATGCAAGCGCGCAATGTCTCTTTCAGTGGCGCGAGGAATGGTGACGCTGGGCAACTTCGATGTG
AATCGAGTACAAACGCAGGCGTGGCGGCTTCGCGTGCCGAATCTGCCACTTGCTGGACGTACTCCACCTACGAACGCGATTGTGTCACTCGACGTGTCGG
GATACGCAAAGGAGTTGACGTATTGGCCGCAGTTCCACAACGGATGCGCGACTGGTTTGCGGCTTCCGTCGACTGATTTGTCGCAGCTCATCAACCGCCA
CTGGATAAAGTATCATCGGCCGACGGTAGTCACAGCCTCCAGCCCAGTGCAGCAACGGCGAGGCCACAACCGACAGCATCTGCCTACCACTGAGACGAAG
AAGCAAAACCTGGAGGAGGAATATGCCGCTCACGCCGGACTCCTGCTGGGTATCGGGCTTCGAGGACACTTGAAATGCTTGTCGATGGCCGACGTGTACA
ACTACCTGTCACTATCGAACGAGTACGTCACAGTTGCGATCTTGCTGGGCATGGCGACAACAGCGGCGTTCAGCCGTCAGCAACGCTCTCGCGAGTCCAA
AACGTCCGCCGGTCACCGCCAAGATGGACAAAGTATTCCTGAACCTGCGCCTTCAATTGCTGCGGTCCCAACGGATGATCAAGATGTAGAACTTGATGCT
GAATTCGATGACGCGGCTTTCGCTTCTCCACACGAGTCAAGGAGATCGTCTTTTTCACCTGGGAAACCAACCGTGATTGGCGGAATGGGTGTCGAGCTCA
CACTTGAACGGTCCGTCTCGAAGATGCTGTGTCTTCACGTCCCATCACTGCTGCCTGCTCCATTTGCCGAGTTCTCTGTGCCCGCTTCAACGCAGACAGC
GGCGTTGTTGGGTCTTGGGATCTTGTACCAAGGTACTGGGTATCGTCTCATGGCAGAACTGCTACTTGCTGAGGTTGCACGCTCGCCGTCATCCGCACAA
TTTGTCGGCAACAGCGGCAACAACAATTCGGGTTTGTCCACGAGTTCGTTCGATCAACTAGAAGGCTATTCTCTGGCTGCAGGACTGGCCCTCGGACTTG
TGCTGCTTGGGCGTGGTCGGGCGACTACGGGAGACCCTGGCCTTGCTGATCTCAATTTGGAGGAGCGACTACACAAGTACTTTGTTGGTGGGAGTCAGCA
GCGCCGCGACACGAGCGCTGCGGGCAGTAGCTTGTACCGCGGACGCCGTTGGACAGGGTTCGGCAATAGCGGCGGCACCAACGGTTCAAACAGCAGCCGA
AGTGGAAGCCGCGCGGGTTCAACAGACACTCCGCGATCGGGAGGAAGCGAAAGCAAATATGCGAATGCGGATCTCTCATCGTCCGAGATGGAGCATGTCA
ACATTGGTGTCACTGCTCCAGGGAGTGCGCTTGCTCTCGCGTTCATGTATTTGCAAAGCGGCAACAAGGGGGTAGCGGGTCTACTCGCGGTGCCTGACAC
GCTCATCTTGCTGGATTACGTGCGACCGGATGTGCTGCTGGTTCGCACTTTGGCCAGAAACTTGGTGCTGTGGGACGACATCATGCCGACTACGGAGTGG
ATCGAATCTGTCCAGCTACCGGCGCAGCTGTTGCAAGCATACTCGCGCTTGGGTCGGTCAGTCCCATCCGACAATGACAACAAGGACGAGGAAAGTCAAC
TCCCTGCGCATGCCGATTTGCGATCCATCTGTGAGGCTTACGCGAACATTGTGGCCGGTGCGTGCTTCAGCATTGGGCTGCGTTTCGCCGGCACAGCAGA
TGCAGCGGCGCGAGGGACGCTGCGCCACTACGCTTTGCACTTTCGCGAGCTGCGCACCAAGGCAACGTCAATGACCGTGATGCTCCAGACTGGGGAGAAC
AACATGGCTGCGGCTGCGACTGAGCGTCCAACGATCGAGCGATGCCTGTGCATGTGTGCCCTCGCTCTCGCTATGGTGGACGCTGGCACTGGCCAAGTCG
AGACGTTGGCGCTGCTGCGATCGCTGAACCTGCGTCAACGTGTGGACACCGAGACGTCCTATGGATCACACATGATGCTTAGTATGGCTCTCGGACTGCT
CTTCCTCGGCGGCGGCCGTGCTACGCTCTCCCGCTCCAAGGACGCAGTGGCAGCCCTTGTGGTCTCGCTGTTCCCTATGGCGCCACTCAACACTGCCGAC
AACAAGTACCACCTGCAGGCTTTTCGGCATCTGTATGTGCTCGCGGTTGACACATCGCGGCTTGTCGAGACAGTGGACGCGGCTACACACGCGAGCTGTT
CGGTGTCTCTGCGTGTCGAGCTGATGTCGTCTAGTGGTGAAGACAGCGGTGTCGGCCGAGTCTTGGATCTCCGCTCTCCGTGCTTGGTCCCAGAGTTGTC
AACGATTCGTCGTCTCGCTATCACCAGCCCCGAATACTATCCAGTCCACATCTCGCTTACTCCAAACGCGGACGACACAGGAGTTGGTCTCACAGCGAAC
GCAGTACGGGCATCGTTGCTACGCGAGAAGAGTGTGATACTGCTCAAGCGCCGCAAGCTAAGGGATGACATGGTCAAATCAAGGAGAGAAGGTGTCAATC
AGGAAGGAGAGCTTGGCATGCTGAGTCCCGACATGGAAGACCGATTGATGCACTGGATGCAGGTGTACATGGCGCCACGCGAAACCGTCAGTGTTGATGA
ACCGCGAGAGCGGTGGTGGTCGTCGCACCTTCGGCCAGGACAGCTCAAATGGCTTCATGAGAACGCGTCGCAACTGCTCCCGCTCCACCTCAACACGCTG
CTCGCACTTTTCCGCCTGCTCCACGGACCACAACACCTCGTGACCTCTACTGACGTGTCGAACCTTCGGCTGTTTACAGACCTGCTGACGAATTCACGAG
CGCAATGGCTGAGACAGGATGCTGGTGGTACCAATGGCGAGTGGTGGCTGCACCAAACCGATCTCGGTCTGCGACGACTCTGGCAGCACAGCGGTTTGTG
CATTACGTCTCTCAGTTCGGCTCGTTCACTACTATTGCATCAACCTACGCCAACCTCCACATCGCCATCGCAGTCGCCGATCGATGTTGAGAGGCGGGAG
GTGCTCCTACGCTGTCTTGTTCGCTATTTTGCTGGTCCAGCGTGGCGAACATTGTCGATCGACTGGAAATCACGGCTCGAGGCGGTGCTGACTGTGTGTT
CAAGCGTCAATTCGGCTGCATCGTCGAGCAAGGCGAAACAATTCGACCTCGAGGGGTTTCTCACTGCCCACGTGCTTTCAAGCGAGGAGAAGACTTTCTG
GCTGCAGCTTGTGTCGTTTTTCGTATATGCTGCATCGTGAGGGCGACACAGCTGAGGTTTGACAAGCGAAGAACTATGCAATGGCGACCTGGAAAGGACG
AAATGCGACCAAGACAAACAACAAGCTCCTTGACTTGCTCTGGTTCACGAGCGCTGCTGTTTATTGTGTTTCTCGGGTGCTAATTTACTTTTTCTGGACG
GTGGCGAGTGCTGGCGGCCTCGACATGGGCCAACCGAATCTCATCTCCTGCGTGCAAGTGTCCGCGTGCTCACCGTGTTTTCTTGATCGGAACTCGTCTG
AACTGCGTCTGTGGTGTGCTGCGCGAGGGGGGAGCATATCTTTTTTCTCTCTTTTGGTGAATGTGGCTTCCCCCGCATTGCTCTTGCCATGCTTTCTTTT
CTTTTTTGTGTGGTGCTCAGAGGCATCTTTTTGGGTTTTGGGCGGCTATATCCTTTTTTTTCTCTCTCTCTCGTGCCATGGCCCTGCAAACATCAAAGCC
ACCTCACCCCAGTTTGCCAAAATTGATTTTCATTTTACGGCGTTTGCGCGGCGAAGACGCAGGCGGCGGCGGCGGCGGCGCAGATGTCGGGGCAGCCACC
ACTGCCGGTGACGACGACATCACGGATGCGCGAATCGGCAGAGTGCCAATGGTAGTCGAGGTCGTGACGCCAATCTCCACCTTCACCACCGAGGTTGACT
TCTTTTCGGGGGTGACGATCGTCCCGTTCACCGCTGTGCCAGTGTGGTCTCTCTTGCCCGCATTATCAAGCGTGGAGGATACAATGGCCGGCTGCTTCGC
CTTGACTGGAGTCGATAACACTTCCTCCTTCGATACATTCGTCGAGCTCGTGGTCTGATCAACTGATTCCGCAGCGGGGTTCGGACTGTTCGGCAGCGAC
TCGCTGTTCTTGCGAGACGGCGCGTCTTCGCCGCTGGCATCATCCGTCTCCTGCGATCCGAGGTCCTTGTGGCTTTCATCTCCAGAGCCGGCAGGTGTCG
CCGTGGCATCTGCCGCCTTCTCTTCCTCCTTCTTCTTCTTCATGTACTCACGGCGGATGCCGCGCGCCACTTGGCGACCGCCCATGTCCTCAAACACGCA
CTCTGGCAACTGCTTCCACACCGTCGCCGTAACCTTGACATCCATCGTTGGCGTGCGCTTGTTCCAGCGATACAGGTCGTTGTGCTTGAAGAACTCGACC
GAGGTCTCAATGTTAACTTCGCGACTGCGCAGCTGGCGGCGGTCAATGTCAAATCCCACAAAGAAACACACGCCGTACGTCGTTGGCGTCGCAGCCGCTC
CGTCACCTGAAGCCACCTGGTTCGCAAAAGTCAACGGGAACTTCTTCGGGAACGCACGGAGGCGGCACAGCGCCGAGTTGTAGGCCAGTGACTCGATCAG
TTTGCGGATTCGCGACTCACAAAAGCCGCACCACGCTTGTTCTTCATCTTCGATAGTAGTGTACACCTCCACAGCCAGATAGTGCTGGTGGACGGAGAAA
AAATCGGACGGCTCAAACAGGGACGACCAATCATCGCAGCCTTTGCTCAAAATGTCTTGGACGAGATCTAACGCTCGCTTGAACTCTTCTTTCATCACTG
CGAGGCTCTGCACCGAGACGTTGAACGACGAGTTCATCGACGGGTACGCAGGCGTCAAGATCGGCATGACTTGGTAGCTGCAGAGTTGGAAACAGTTCAA
AACGCACATCATCAATATCCCGCAACGATTCAAGATCCGAGACGAGGTCATGACGTACCGGTTGTTGCCGACGTTGGCGTTCCAGACTTCCAGGCCGAGC
TTCGCGTCATAGTTCTTGCAGAGCTGTCCACACATCATAATACTATTCAATAATGTCACGAACCATCGGAACCGAGTCGAACGACACTTACCTGGACGGC
AAGTGGCCACTTCCAGTTGGAGAGCACCATGAAAAAGCGAAGGAGCAAAGTGGAGGGGGCCGCAGTCGGGTACAGTTGATTGATAAAGCACACCAAGATG
CACCAGTTCACACCGCCTAGGTACCCCATCTTGTTCGAGTAGAGTCCGCGGCGCTTGGCCCAGCGGCGCACGATCCGCAGCACACTGATGAAGCTCTTGC
GGTTCGGCGTCAGCTGCATCGCAAAACACGAGGTGCAAGTCAACACCATTGATAGCATAACACCAAGTGAGACCATTGCATAACCGACCTTGATCATGAG
CTCGGTCACGCGCGGACCGTTCAAACTCTTCTCAGTCGCCGAGTCGACGTCGCGCAGGATCTGGTCGTCCAGGATGTTGAGGTTGTCGGGGATCGTGTTG
CGCGGCAAGATGGCGATCTGCAAGTCGATGTTGATCTCGTCAAAGTCGAACGTGAGGATCGGCACGATCGCGCCTTCGATGGCGACGAGGTTCGTCACTT
TCGGGTGCTTCAGGAAGATCTCCTTGAGCGACGAGAAGAAGTCGTCGCGCGTCACATGGCGCGGCGCCTGCTCAAAACCACACCACGATGCATTCGAATC
AGCCTCCATTTTCGCTCTAAGACGCTACACATCCTGCCACGTACGACGCAAATCGTATCGATATCCGCGCCAGGCTCGTTCACGCCGAGCCGGTACGAGC
CGGACACGAGGATCTGGCCGCCTGCGTCCGCCGCAATGTCCTCCGGCACGCCCTTCTGAAGGCAGACCTGACATGTTTCCACCCCACAGAACACGTCAGT
AAAGCTCTCTATCGCACCTCGCCGTTAAGAACGATAAACTGGAACGTACGTCCTTGACCCACTGGCGGAAGATGGCGCGCAGCTCCGCCAGGATCAGCGA
CCGACGCGTAATGTTCTCGGGCGACTCGGTCGGGTAGTTGGCGTCCATGAAGGCCTGCAGCTTGGCCGACTGCTCCAGGTCCTTCGCCTCGGGCGGCGTC
GTGCGGATGGCCTTGTACGCCTGCTCCAGCACGTGGGCCGCCACCGTGAACGTCGAGCTCTGCATGGCTCCGCTCCGCTCAAAAGGCGACTGGGTCGAGC
CGAGAAAGCGGCGGA