Description :
From Genome Similarity Track
Location :
Scaffold_89:45490- 49086
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_89-snap-gene-0.46Conserved gene of unknown function
Pytve_DAOMBR484fgenesh_masked-pve_contig_89-abinit-gene-0.92Protein phosphatase PP2A regulatory subunit B

Sequence
3596 bases(100 bases per row)
CCCCAGCGTAACCCGTTTCAAACCCACCCCACTCACCTCGGTGATCGGCATGAACACGTAGCCGAACTGCTCCTCGACGACGGGCAACTCGGCGACCGCG
AACAGCTCGCTGTCGGCCGCCAGACTCGACATGTTGGTCTCCATGTCGTGCACGAGCTTGCCGAGCGCGGACGAGTCGCCGCCGTCCGTGTCGGCCGCGT
CCGCCTCGGCGCGCAGCAGCTGCAGCTTGCGCTCGNNNNNNNNNNNNNNNNNNNNNNNCTGCTTGCGACGCTTCTCCTCCGCGTCGTTCTCCAGCAGCGC
GTCGAGGCTCGCGAACTCGGCGAGGATCGCACCCGACGCCTTCTTCCGCCTGTGTACCCATCGATCGCTAGTTAGTACATCCCAACGTCCAGGCGAACCG
CTGCATATAAAACGGGACGGACTTGGCGTTCTTGCGGCCGTTGCTGCTGTTGACCTTCTCGACGAGCGCCTCGGCCGCCTCCTCGTCCGACAGGCTCGAG
TCCGAGCGAGCACGCTTGCGTCTGCCTCCAGCGGCGGCCTTCACGGTCGGCGCCTTGCTCGCCTTCGCCCGGGACGCCGCGCTGCCTGCCGCTCTCGCGC
GCGCCATGCTCGCCGTTGACTTGCCTGTCTAAATGGCGGCGCCTGTGTTGTCAATACGTATATTTTCATTGGCTTAAAATCTGCTCAAATGATCATGATT
TTAAGCCAACGAGGAGGCGCTGCAAAATAATAAGAGGCAAGCGGTAGTTTACCGACTTTCGTACAGTAAATCCATTCCGACATTACAAAAAACGTCGGAA
TGTGAAGCCAAGGCTTGCAGAAACACGCCGAGCGACAGCTGGCCGCGATCTTGGCGTGCAAAGCGCGCAACTTCAACCTGTGCACTGTACGCCAGCGACT
GGCTCAGGCTCGCCCCCACCACACCCTCGCGTCGCGAACACCGGGCCCGAGGCGGCCGCTGCTGCCTCTCGTTATTATAATAGAAAACGGGGATTAAAAC
AGCCGTCCCTTGCCGCGACCCTCCTGCGGAGAGGGACGCGAGCAGTCGCAGTCGGTTAGCAAATGTATCCCCCTACGGTACGGCGCGCAGTCGGTTAGCA
AATGCATCCCCCCTACGGTACGGGCGGTCGGGGGGATATATATATATTCCGTGGATCTTGTGGATGGATGCGTACATTTTCGTAACAGGCCGTGCCTGTT
CGGCTCGGCCGCCGCCGTCCTCGCGCCAAGCGAACGTAAATTTACTGGACCATTTCGATTGAACAGGGGGCTCGTCCGCTCTCCGCTTCGCTGGGCCTTT
CTATGCTAGCGCGGTCGCTTCGATTTTTTCTTCTTTTTTCCCCCACCATTTCGTTCGCTTTGCTTCGCGAATCACTTTTGTCGCAATTACCTCCGGCTTC
GATTGGCTAGATTGAAGTTTCGGCCGCCTGTCAGCCGGCAAGCCAGCGGTAAAGATCGCTAAGCCGCTTCCGAAAATCCGTCCCCGGTTTCCACCGCAAC
TATGAAACGAAAGAAAGAAAGAAAAAGAAAAAAGAAAAAAAAAGGGTAAACCAAAAAAACAATACAATAGATAAAACACACCCGCGAAGGCTCGCTAAAA
AAAAACACGCCCATGCGGTAGAGTGGCATTTGCACCCGGACGGAAACCCCCGCTGGCAGGCGATCCACATCCAGGGGCGGGCGGGCAAGACGCAAAACTC
CCCCAGGCGAGCGGCCGCTGCTCCATGACGCAGACGGTGCCCAAGGCCCAAGCCGTCGCCCACGCCAAGTGCGCGCCCGACTCGTTCAGCGCCACGTCGG
CGCTGGCCGCCATGGAGCCGCAGCAGGACTGGAGCGTCGCCTTCTCGGCGGGCGACCGCGCGCGGGGCCACGTCGAAGGTAACGGGGGCGTCAATTGTGT
GGATTTTGCGGATTTACTGGCACTTTCCGGGGGGCTTATCCGGACGTTGACGGTCAGCGGAGGTCATCTCGGCGGTCGAGTTCAACCGCACGGGCGAGTT
CCTCGCCACAGGTAACAAGGGCGGACGCGTCACCATCTACTCGCGACGTCACAGTGCACTGCCGGTATGAATACTATGGAATATTATTTAATGCGCTGGT
GGATGCGATTAGCTGACTATGTGAATGGGGAATGTATCGGCCTGGAACTGTACGCGTCCAGCACGAGAAGCTCGCGTTCGGCGCAGGCGTGCAGTACTCG
ACGTACGCCGAGTTTCAGAGCCACACGGCCGAATTCGACTACCTCAAGAGCCTTGAGATCGAGGAGAAGATCAACCAGATCAAGTGGTGCCGTCCATCCA
ACAACGCGCAGTACCTGCTCACGACCAACGACAAGACGGTCAAGCTCTGGAAGGTGCACGAGCGGAACGTGCGCGCCGTGACGCAGTACAACGCGCAGGC
GCTCGAGCGCGTGCCGCTCAACAAGCTCTCGCCGCAGCTCATCCGGCTGCCGCAGTGCTCCATCCGCCGCCGCGTGACGACGTCGACGCCCAAGCGCGTG
TTCGCCAACGCGCACACGTACCACATCAACTCGATCGCGCTCAACAGCGACGGCGAGACCTTCCTCTCGGCCGACGACCTGCGCATCAACCTCTGGAGCC
TCGCGCTCTCCAACCAGAGCTTCAGTGCGTGCAGACTCGACCCACCCTGTGTGTGCACACAATAACCTCGATCGTACTAACGTGGTTGGTTGGTTGGATG
GCTGTCGCAGATATTGTCGATATCAAGCCGCAGAACATGGAGGAGCTAACGGAGGTCATCACGGCGGCCGACTTCCACCCGTGGCACTGCAATATCATGA
TGTACAGCACGAGCCGCGGCGCCATCAAGCTCGGCGACATGCGCCAGGCCGCGCTCTGCGACGCCTACTCGAAAGGTGCTGGTCTGCTGAGCTCTCTGCT
CGTCAGGTGCTCGTTTTCTCATGGTGTTCTGCCGCCTTGATACAGTTTATGAGGAGCAGGAGGACCCGGCGGCGCGCAGCTTCTTCTCTGAGATCATTGC
GTCCATTTCGGACATCAAATTCTCGCCAGATGGTCGCTACATCATCGCCCGCGACTTTCTCACGCTCAAGATCTGGGACGTCAACATGGACTCGCATCCT
GTGCAAACGATCAATGTGGGTGTCTATACGTAATCCGCCTACTTTCTATCCGTTCGAACTGACTGATTGTGTCCGTCCAGATCCACGATCATCTGCGCGA
CCACTTGCCGGACCTGTACGAGAGCGACTGCATCTTCGACAAATTCGAGTGCGCGGTGAGCGGCGACGGCAACCACTTCATGACGGGCTCGTACAACGGC
GAGTTCCATATCTATGATCGCTACGGCCGCAGCGACGTGTCGCTCTCGCCCAACCTGGCAGTGCGCCGTCCGGGACGCGGCAGCTCGCTACCCCAGCAGA
TGCTCGCACAGCAACTCGCGCGTATGCCCGCCGCCGGCCAGTACGAGGCGCTCGACTTCACCAAGAAGGTGCTGCAGACGAGCTGGCACCCGTCCGCGAA
CGAGGTCGCTGTCGCCATCCGGAACAATCTGTATGTATACTCCACGTAAATCACAATCCGCGAACCGCCAACGAGAAGCAGGACCACCCCAACAAC