Description :
From Genome Similarity Track
Location :
Scaffold_153:45480- 48870
Transcript NameFunction/comments
Physo_143828hypothetical protein
Physo_143829hypothetical protein

Sequence
3390 bases(100 bases per row)
CGAACAAAGAGCTGCGCGATGCCATGAAAAAAGAGATCGAGGCCAACGAAGACCACCGCAAGACGATTGAGCACCAACAAGACCTTATCGACAAAGGGAT
CAAGTCCAATGAGATCCAGCAACGCATGATTCAGGACCTGCAACGCGAATTGCCGGCTCTTCGGCACCAGCTTAGACAGCAGCAAGTACAGAACCATAGT
GATATGGACAATCTGCGTCTCGAGTTTAGAGCACAACGAGAAAAGGATCGTGCATTGGTCGAGTCCAATCTTCGGGCATTGAAGCGATATCACAACGAGA
CCGCGCGATGCCGACCAGAACTGAAGCTACTCGCGGTCTCTTCAAATCGACGGACAGCCTTGACGATAAACGAGGGATCCATTGGAGGAAAAATGCTAGA
ACGCGTTCGTGCGTTCAATGAAAACAGACGCGCTGATGCGAGAGCTGAAGAAGATAAGCGCGTGAAGACGGAGATCACATTCCACCACTCGAAGGAGAAA
AATTTGAAGAGGACGATCTCACGCGGCAAGCGCACGCGCGAAATATCGGTGAAAGCGTCGGACACGGTCGTCGTCCCCGGTGTGGTGGACGAAGCTCGTC
TAAAAATCGACAACGCGCTCGATGCAGCGGGGCTGGTCAGTACATCTGTTCGTCAAGATATTTTCATTGAACTAATTATCTTCTTTGCCTAGGACAGCGT
GACGAAGTCGCGATTCGATATCTCCGGCGCGGCATCAAGTACGACAAGCACGAAGGCGTTGACGAAATCGTGTTTGATAGCCTCGACGAAGTCGTCGCCA
GTCACAGAGCGTCGTCGAGTGACAAGTACTGCAAAGCGTCGACGTACTTGCTCTTGAATGACGTGCTGGTGACCCCTGTGTGGCAGTTCGAAGTGGTATA
ACCAATCAAAGTTCACTTCTCGTGAGAGCAAAAACATGAGATGCTCGCGATGCAGCAGTAGTAGAGCACTGGTACACACCTCACCTCGGGCACCTCCTTG
GTGTCCGGGATCAACTGCAACCTCCTGTCTCTTGCAGGAGCAATCTGACCCCTGCTAAGTTCAGAAGAAGTGTCGGCATCCATATATTCAGCACAATAAG
GAAATACTAGCACATGTAGTACTTTGGACCAACCTCGTGCTCAACCAGCACCTCCATTTGCTTATGAGGTCTGTCCAGATACTAAGCTTAACGGGAGAAT
CAGGGTGGGCTTCTCAACGGTCAAGTCTAGCACGACGCTAGCTTCGTCCTCGCGCAGTAGCAGCTGGGTGGCATTCATCAGCGCGTGACTCACCATCGCG
CCAAGTACGCCTTCAAGCACAAAGTCCACCAGCTCCAAGACATGTTGATGGTAGTACACCACGGATCGGCTCGAATGCCAGGCGCAGAGAGGTCTGGTCG
CTCGTCTTTGGGTAGCTCACAAACGCGAACGTCAGCTGCGCCTCTGGTTCCATCCCGGAGGCAACGCGACGTCGAGTTTCCTCCTCGTCCAGACCCAGCA
ACGGCGAATACAGCGGATGCTTCGACGTGCTCAAGTCCGTGCCCACGAAGTCCCCCACATGACCAGTAACCTCGAACGTGTCCTCGTCAGCAGAAATTTT
GCCTTCCACATCGTAGCTCGTGTAATTGACACCGGCATTGCTGATGTCGAGACGCGCAAGCTGGCGATGAAGCTGGTCCTTGTTAAACGTCAGACTGAAT
TGTACCAGCGACGCGCGTATTATAACGAGCGGCTTTCCTCTAGAGCGCAGACTGGTTAACGCAGCAGCCTCCATCTCATGGTCACCACCGGGGGGGTGAC
TCCTTTGTAGATTCCTTCTCTGCTGGCAAACTTCGCGGCGGTGTGGCATCTTCAGACGGGAGATCATAGTCATGAGACTGAATTGCAGATGCGTACGCGG
GTATGATGCGGTAGAACAGCGCCACAGACGACGGGTTCCTTTGCAGATGCAGCACGTTCAACTGCACGTCTGCCTCCAGTTGCGATGCCTGGCCACTTTC
TTGTACTCTCGGTACTCCATTATCCTGAGAAAACGCCGTGACGTCGATAGCGATCAGGTGTGGAGTCTCGCCTGCGTCGTCTTCACCGGTAGAAATGAGT
TTGTAGTAGCGAGACTCGGGCGAATACAGTTTATCTTCCATCACAAGGGCCTTCAATCGTGCGTGGAAGTCCTGGAGGGCTGAGTACGCTTCCATCGAGA
AGGACGTTTGCGAGGCCCGCAGGATAAATGCGTCCTTAGCAGCCGACTCCCGCAAGTTGAGCTCCACACATCCAAGCGACAGCTCCATCTCCAGCAGGAA
TTTCTTCTCGGATGTTATTAACGGGAACGACAGTGGCATTGCTTGTACCTTCATCAATCGTGCTTTCGGAATCCGTCGCACTCTCTTCGTCGCCACTCTC
ATGATCTTGATCCTCGAAGTAGAACAGGAGCCTACCGTTATCCCGGGCAATGGTCGCGGCTTGTGCAACTATGGACGAGTGGATCTGGCCCAGCGCCACA
AGCTGCTCCTCCACTAGGCATATCGAGATCTTGGGAACGGCAGCGTAGATGCCCAGTTGCGGCAGCGGCCTTGCCTCCACGTCTTTCCGTCCAGTACGTG
AAGAAAGTCATGAGCTAGCTGCGTGTGAAGTGAAAACTCAATCGACAGCTCCTTCACAATCTTGTTGACGCCGCGGAGTTCTTCGTCAGACCAGTCCACC
AACTGCTCCTGCCGTCCGAGCAACACGTGAATCTGGGTCACGTGTAGCCGCCAATGCAGTCGACGGGGATCTTCTCCTGTCGTTTCCAGCCGTGTCGATA
GCCGTAACCTTTATCAACCGTCATCCGGACAGGCTCCCTGCGGACGCGGACCTTCAGCGTGGCTTCCACGTCATCGTCACCCTGCCGTTGGGTCTGTAGC
ACCGCCCGACGACTCACGTCGATACTGACGCAGCACGTACCCGGGCCTTCCCACGGCGATAGCGACGATGCCGGGCTACAGAACGAATGGAACCGAAAAT
CGTGTGCGAGCCCGTTAAAGAGGTCGAAGTGCTGCACTTGGAAGCTCGCGTCCCCTCGTTTTCTGGCTGAATGTTCACAGCCAGCGAGCCATTGAACATT
ACAGTCACGAACAAACTCTCGTGTGCGTTGGATTGAAACAGCCATTTGTCAGCTGAAACTGCAATCGGCACTTCGTGTGCGTTGCTAGCCTTCTCCACAG
CGTTATTGTAAGCCTCGCGTAGATTTTCCCAGCCCTCGGCAGACAATACGTGCTCCTCCGCTGCTTCACTTGACGCGGGAGCAGATTCACTTTCGCCGAC
GACGAAATACGAGTACCACGAGCCACCTCCGCCATGAGTCGCCTGTGTTTTAGCGTGTTCTTTGGCCGAAGCTTCCACTTCCTCCTTCGC