Description :
From Genome Similarity Track
Location :
contig_166:4548- 6992
Transcript NameFunction/comments
g14520.t1hypothetical protein

Sequence
2444 bases(100 bases per row)
GCTCGTTCATACCGCAGTAGTGCTTCCGGAAATGCTGCTGAGACGACACATCAGAAGCCGGATGTGAGAGGCTCTGATGAGATCGTCGCGGCACAATTGC
AAGCTACTTTGCAGGCATTTGCTGCTGACAGAGTTTCGAAGAACCTGATGGGAAAAACCGTGAAGATTTCTGAGCCTATTGTGAACGTGAAAGCGGAACC
CGTTTCTGAAAGTAGAACTTTTGCAATGGGAAAGGCCGAGTTGTCCTCTGGAACCAAGTCAACTGCACCTGGAAAGTCTGTCAAACGGCACATGTCCGAA
AAATCTGGTTCGTCCAAGAAAAGTTCGACTTCCGGAAAGGGGAAGAGGACGAAGTAGTCATCTGGAAAGTCAAGTGATCCTTCGGATTCGGATCCAAGTT
CTGAGTGACTCGTACTCGGACAGTTCAAATAGCAGCTCTTTCGAGGATGTCGTTCCGAATGTCCATACGACATCGGGTCCAGGCGGATCTCTGTTTTACG
TTCAGGCCGTACGTGAATGCCAGCACGTTGGAAGACTTCAATGAGAAGACGTCACTAGCTACCCGTATCCGGTGGTTGGAACGATTCCAGAGTTTTGCCG
TTCAGGGTGGTTGGTCGGATAAGGTCAAGATCTATGAGATGAAGCTGAAGTTACCTGCTGCCGTTCGAAACTGGCGTTCGAACTTGAATCCCAACGTGCG
CCGGAAATGGAAGAAGTTCCTGAAGGAGTTCCGAGATATGTATTGCAAGGCCAAGACCTCGGATTCAGAACGTTATTACACGATGATCCAAAAGAAGGCA
GAAACTCCGCTGGAATTTTACTACCGCCTGAACAAGGTGGCCGACAAAGCGGGGATCGAGTTCGACGCATCGAGTAAGCAACGTGAGCGTCATCTGAAAG
TGTTCACGAAAAAGCTTCTGGACTCTCGCCTCCGAACGACTTTGCAAGGACAACGTCTGCGTCGTCTGAAGGACCTGGAGTATGTCCTGAAACAGCATGA
AGAAATGAATCAAGACGACGACTACGATACTCCACCTCCGAAGAGAGACTTCCGAGCGGACAATGTCCCTCGTGATCGATTCAGACCGAAACGTTCTGGA
AGAGCCTACGTCCTTCATGATGACGATAACCGGGATGGCGAGAGCACGACAGACAAGTCCATTTTTTGGAAGAAGTGGAAGAAGTGACAAGTCGAGATCA
TGCTCCTAGTGTGCTGACTACTCCAACTGCGGATGCCACGAACGTGTCCGGTTCGAGCATGGATAACCTTTCCGAAGCAGTATTTCGTGCGATGGAGAAT
CCCGGATGGCGGCCCCCGACTTCTGATTTCCGTTCGGATCGCCGGCGGCAATATTTTGGAAGTCCGAACGCGTCCAAGTTCTGTGACAAGTGCAAGGAGT
TTGGACATCTGACGGAGAACTGTTGGTCGGACATCGAATGGGACATCCGACGCACTTCTGCAGGACTCGTCCGTGTGCGATCTGTAACCAGTTTAACGAA
GGCAAATGTGGAGAGTGGAAGGCTTTCCAAGCGATCAAGAATCTTGCACGTCAAGGAGCACTGAAAGATCTGCCGTCTCCTATCCGGAAGCAACTTCTGG
AAGGGAAGGTGGATCCAGGGGAACAGCCGTTAAACTAGTAAGCCCGCTGGATGGGGATCCAGAACGCGACGGGCTGAAGAAACCGCCCGATATGTGTCTT
CTAGTGTATGTTGGTCCGGAGTTGAGACGCCAAAACCAAGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCCTCTTTCAGATGAACTTC
GTCCTGAACGAGTTCTATCGGAAGGTGTACGGCCGGAATACAAGATCCGGATGTACCTGTTGAATTCCGATTGGGGCCAGGCGAACGATATGGCTGGTGG
GAAGATCACTGTTCGGATGACACGAAACGGATTGCGATGGTTCACGGAGCGGTGAACAATTGTCGGACAGACATCCTTTTGGATTCTGGAGCGTCAGTAA
GCATGGTGAGTTTGGATCTTGCGCGTAGACTCAAACTCAAGTTAAGCTTCTGCAAACAGCTCCGGGTATCTGGACGGTGGCGTTCCGACCATCATCACCG
CGAGTGCTGAAGTGAAAATCACTTTGGGTCCGAGAATTGTGTATGTCTTGGAACTTGGGTCGCGAACATTGGTGAAGGTGTCGACGTGTTGCTTGGAATG
AATTTCATGTATTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATCAGGACGTGGTGCGGATC
ATTACCACAGAGGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGTCCAGGTGAACATGCTATCGTCCGGATACATTACGGACAGAGCAA
TCCACAACGTGATGTGGTATGGGCTGGTCGGGGAGACCGATGGG