Description :
From Genome Similarity Track
Location :
Scaffold_1849:4548- 6077
Transcript NameFunction/comments
Phypl_g14261hypothetical protein PITG_23337

Sequence
1529 bases(100 bases per row)
ACTGAGACTGTGAACATGGTCAAGCTACTGTGCAGAGATGCAACTGGCGGGGACTTTTACCTGATATTTGGAGCGGAGGGTGTGCGGACTGTGTCACCTA
CAGACAAGCGGAACATTCTGCAGTTCAACATGACGTACAAACATTCGACAGCAGTGCCGACGGATGCTTGGATTCGCGCACCTGTACCTCTTGCGGTTGG
TGCGGTAGACCGTGTCACTCTGTTCGTTGACGTGACATTCAAGGTTACGCCGAGGCCGTTCTCGCTAACGCTGATCGTAATGCTCTATGATCGTGCTCAT
GACATATATATTCCGGTCTTTTACATGCTGATGAATTCAAAGGACGACTGGAGTTATTGTCACGCCTTTCAGTGGATTCAAGTTCAGTGCAATGAGCAGT
ACGTGCCCTCAATTGTGCTTTGTAACTTCTAAGCCGCTCTTCAGCAAGGTATCCGAGATCATTTCCCGTCAGCGTTATTGTCGGGAGCCTGTTTCACTGG
AAGCAAGCGATTCGACGGAAGATGGCGTCTCTAGGACTCCCCTCGGAGCCGATTCAAATCGCGATGGAGCCTACCATCCTGGACACACTGACCGTGGTCT
CGGAGGACAAGATTCTCAGCAAGGGCATCCCGTATGCCGTGCAACACTTGTACGTTCGTATCGATCGTGATGCCGTTAAGACGAAGTGGGATAAGATCTG
GAAGTACTTTAAGGATACGTGGATTATTCGGTATAAACCCAGTTGCTGGAACATTTCAGCAATGCCCGCGGCGCAGGTCTCGTTGGTCAATCACACGAAT
AACCCACTTGAGGCGTACAACAGAGTGCGCGCTGATCGGATTGGTACGACGCAGCCGCCGCTACTAGCTTTCATCAACGAAATATAGCTGGAGTCGGCAA
GATATCTGCAGGTACTATATGACACCCGTCTATGGCGGGTTGATGAAGTTCGAGCGACATCCAGCGTGGAGTACCCCTCCCCCTGCTCCATATTTAGACT
GAAGCTAACGCTCCCAAGCTACCCTGAAGCTGGGCCAAACTGCGGAAAACGTCTTCTCTGCATTTTGTTATAAATTGATTGCATATTTCAAAGGGTTTTA
ATTTTGTTTTGGCTCGGATATATTTGCGCTTAAATGCCTGTGACGTAAAAGCAAGTAGTTGAAGCTGACTAGCAATACAcaatgctgctgcgggtggTAA
CCAACACCCGTACGACTTTTGAAGTTTTCTGTTCCAGAGCCAAATGCTAAATCTTCACCCCTAAATGCACTGAAGGTGCTCCGCCTTTGACGAAGTTAAC
TACATGCCCATCACATAACAGCGGAGGTAACATGAGCCCGATCCAATAGTATAAGTGTATGCATTTGGTCCAGACATCGAttcccgcagcagcaaaaggG
GGTGATCCAAAATATCCCCAACAAAACTTCCCTTTTAGTGCGTAATTCAAGCCACAATCATTAGGTACGGTGATCTATCGAGATACCGAAATTTACTGTT
AGGCACTTTTAGGCACTGTTTTGAGGAAA