Description :
From Genome Similarity Track
Location :
Scaffold_3:4547262- 4554056
Transcript NameFunction/comments
Physo_287169Hypothetical protein
Physo_490694Hypothetical protein
Physo_491465succinate semialdehyde dehydrogenase putative

Sequence
6794 bases(100 bases per row)
GACCCTGCAGGGAGACCCGCGCCGCCCCGGCGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCCGACGACGCGCCCGGCGACTGGTACGCCTTCTTC
TCGCTCGTGCTGGGCTTCCTCGCCTTCACCATGAAGGTATAAGACAGCTACTATGATTATATGCCACGACTGTTATTACGGTAGTTGTATTCGCTCAATA
CTAACGGCGTCGTGTTGCGATATGTAGTGGAAGGAGCTGGCGTGGGGCTCGCTGCTGCTGTGCGTGGGCTCGTTCACCAACATGAAGTCGCAGGACATGA
ACACAACGCAGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCGCTCGTGTCCGCCTACATGGGCGCCATGCATCCAGGCATGCCCATGCCCCCGTCGGC
CCAATCGGTCCAAGCGCCGGCTTCGTAGACGAGAGAGGAGAGAAAGGAGAAGGTAATAGGGAGAGCATATCCGATCCAGGCTGCGGGCAACGAGCTCCTG
CTGTAAGGAATGGAAGAACAAGAAGCTGTTTGGTACTGTGCTTTGGCTGTGTTCAGCGCAGTTTGGTTGAGTTTTTCACGGTTGAAGTGCATTTTACCAG
GTAACGACCGAGTGGAGCTATTTCGGAGAGCTAACTAACGTGTCTTTGGGCTGGCCTGCAGCGTGCTATGACTCCTATGACTCCTGCAACGTTTGCTGCC
AGACAATGACAATTGGTCTTCGTGAAGCGCATCCTGAGAGCTTTGGAGAGCAAGCGACACGGACGAAGGACTCGTCTCGTGAGGATGGAGAGGGGTATCC
AAATGCCAGTCGGGAGGCTGCGGCCGTGCTGCCCCAGAAGCTGCTGATGAAGCGGCCACGCGGACCTCCACCAGCGCCGAGGATCTTGCCACCTATCCGA
CCACCAAGTTCTGGCGCGACTGCAGCAGTATCATCAATTATGACTCTGGAAGAAAAGCAGCAGCGGCAGATGCACTCGTTCCTGCGCAACTTCCTTGCTG
CAGGAGAGAGCGGCCGCTTCCAGCAGGTGATCGACCTCCATCAGCATGGAATCGACACGGGCATCACCGTCACGGACGCGACGCTGCAGGAAGTTGTGCT
CACAGTGCCGAATCTGCGCGGGTTGAATCTCTCTGGGTGCTCACATATCACGGACGCGGGGCTGTGGGCTGTGGCGAGACACTGCCAAGCACAGCTGGAT
ACGATCTACCTGGCCCAGTGTGAGAAGGTGACTGAGCTTGGCCTTCGTCTTCTCGCGCACAATTGCAGGTTAGTGCTGGTGGACCTCAGCGATTGTCCAC
AGCTCAACGACGCAGCTCTGCAGACGCTGGCAGCTGGGTGCTGGATGATTGAGACTTTCATCATGAAGCGGTGCAGAGGCGTCTCCGATGCTGGCATCGT
CAAAATCGCACAGTGCTGCAAGGACCTACGCCACCTCGACGTTTCCGAATGCTCTCGACTGGGAGAGTACGGAGACAAAGCTCTGCTTGAGATCGGCAAG
TGCTGCCCGAAGCTGCGTGTGCTAGACTTATTCGGTTGCCAGCACGTGCACGACCCGGGGATTCGCGCCATCGCTAAAGGCTGCCCTCTGCTGACGACGC
TGAAGCTGACTGGATGTCGAGATGTCAGCAGCATTGCTATCCGAGCGCTGGCCCAACAGTGTACTCAGCTCGAGGTTTTGTCACTTTCTGGATGCATCAA
GACGACGAACAGTGACCTTCAGCTACTTGCTACCAACTGCCCGCAGCTCACGTGGCTCGACATCAGTGGTAGCCCCAACATTGATGCACGCGGCGTGCGT
GCACTAGCTCAGAACTGCACGTCGTTGACGTATCTGAGTCTGGCTGGGTGCCAACACGTTGGGGACGCTGCCTTAAGCGAACTTACCAGTGCCGGAGCGG
GAGGACTCACCAAGTCATTAGGGGAACTGTCGCTCGCAGACTGCCCTCGTGTCACGGAGAGTGGAGTCGACGCGCTAACCACTGTTTGTACCAACCTTAT
CACGCTCAACCTCACGAATTGCAAGCAGATTGGTCGGAGGTTCCTCCAGAAGCTCATTACCAAGCTTGAGTTCGTGCAGTGGGCCACGAGTTTCTTCGGC
TACGAACCACTGCCGAACGCCGCCGAGCTGTGCCGTCAGCGCGACCTCCGCCTGCTGCAACTGGGAAGTGCGATCAAAATTCAGTCGGCGATGCGCGGGT
GTCTGGCTCGAGGAGGGCTCTGGCAAGCCAAGCTCAAGTTCGTGGAGCGGAGAATTCTACCTAAAATCCAAGCGCGTGTGCGCGGATTCCTGGTCCGGAA
GCGTCTTGCAGCAGAGAGGAGATACAAACTAGAAGACCACGCTGCGTGGTTGATCGGCCGAGCATATCGAGACCTGCAGCTCCGACGGATGCTGGCTCGC
GCAAAGCGAATACGACAAATCAAGGAGCACGAGGACGAAGCAGTGCTCATTTTCCAGAAGATATTCCGTGGCTACCGAGACCGCAAACTTGTAGCGAAGA
TGCGGTACGACATTTACTGCGAGCAGCAGTTCCAAGCTCGCGTTTTGGCCATGCAGAACTTGGCGGCGACGAAACTGCAGCGTGCGTACCGAGGCCACCG
AGGACGGTCTGACGCCGCCATGCTGCGCTCCATCAAGGAAGCAAAGCGTCTCCAGCACGAGAAAGAGGTTCGCTCTGCGGCATTCTTGCAGCGCGTGTAT
CGGGGCCACAAGGGGCGCAGACTTCGAGCTCAACGCCTTGCAGAGCTGCTTCACCAGCAACAATGCCACCAAGGTGCCATCAAGATGCAAAAGGTGTTCC
GTGGCCACCGCGCGCGACGGTATGCAGTGATTCTGCGCGCTGAGGCAAACGAGCTGCGTATTCTCAACGCCGCTTTAACCATTCAAAGGTACTGGCGAGG
CATTCGCGACAAGCACTTGGCTGCCGTGCTCATTGGGCTCATCAAGCTTCGAGCTAGAGAGAACGAGGCCGCGCATTCAATCCAAGCTGCTTATCGAATG
CACGCCTCTCGAGGATTCATGAAGGCGATGAGGCTAGCTATGGCCGCGCAAATGAGAAGGATAAAGGCTGCAACAGACATCCAACGGATGATACGAGGAC
ACCGTGGGCGAGCAGATGCGGAACTGCGGAGAGAGCTGCAGCGATTCCGCCACCAAGCCAAACCACTATTCGCAAAGGAAGCGCGGCTGCAAGCGCTAGT
GGATGACTTGAACGAGAAAGTGGAGCAGCTTCAACGCAAAATCGCAGCCGACGAGGAAGAAGAGCGCGCGCTTACACTGGAGCTCCAGAAAACGCTGCAG
ATTAAGACCAAGTACCACGACTCGAGTCGTATTACCGGGACCCCGCAGCGCTACCTGACACAGTATCTCCAAGTGCAGCTTGCTGATCAACTACGAGCTA
AGCGCACCGAGATCGCGCTTGATGGACGGGCGTTTGAAACTCTGACGACAAACCTGAACGATGCCCAGAAGCAGTTGAGAGGAGTCAGGCGAGAGCTGGA
GCCGCTAACCGAGGGCGTCATCAAGAAAACACGCGAAAACCGCGTCAAGAGGCTACAGGATAAGGTTCGCCACGAGCGCCGCGCCGCGGTCATGATCCAA
AAGATGTTCCGCGGCTTTCGCGTGAGATCCGCGGTTCGAGAGGGAGGCAATTGCTGGATTCAAATGGCTTCACCCGACAACGGCCGGCCATACTACTACA
ATGCGCTGACAGGGGCCACGCGATGGCATCGACCACTAGCGATGGACATCTTCAGTGACCATTTTGCGGAGCCGATGCAGGAGCCCGTGGTAGAACAAAT
ATCGTCCCTGGAGCCAAATGCAGTGCAAGGTACAACGAGTCATCGCAGTCGTTCGGATCGCGATCAACCACCAAGTTCTGCGAGCAATTGGTACGAAGCT
TTCGATGACAAGATCCAGGCGCCATACTACTTCAACAGCCAAACCAAAGAGTACCAATGGGACAAACCCGACGCTGTCGATAACGCGTACTTCACGGACA
CTCAATCGTCTCGAAAACGGCGCGAGTGGCTCGAAGACCAGCAACAAGACATTGAGGGCCTTCTAGCAGCTACGCAAGTTCGTTTGCCGCTGTTGGGGCA
ATGGGAGAGGCGTGTGGACCCGTTGAGCGAGCATCTTTTCTTCTACCATCCACCGACAGGAGTCGTTAAGGCTTCGCTGTCGCCACGCACTGTGCATGCA
TCACTTGGGGACACGACCATGAATTCGCGCCGCTCTGCTCGCAGTATTGGAACTTCTCGCTCTCTCCATTGGCAGTACCGATACGGCTACGAGTATGATG
CGAATGGCAAGCTTGTGACGAGTTCCAGGTCGCACCCCCGGCCAATCTGGACGGAGCATACCGATCCGGACAACGGCTTGACCTACTACTACAACGCGCT
CACGAATGAGTACCGATGGGAGAAACCCGAAGACTTCGACATCAACTACGAGGCGTTCGCTAGTGGACGAAGCGCGAGCAGCTCTGCTCGTAAGTGGTTC
GACATGGCCCATCAGAAGGCAAATGGAGACGGCAGCAACTCGCTCACGACCCGATCGTCCAAGTCGCGCGCTCTGGGTAAGAAGTGGGTCGAGCTGGTGG
ACCCAGAGACGCAGAACACGTACTACTACAACGAAGTCACGGGCGAATCGAGGTGGTCGCTCTCGCCGCGCAGTGCTCGCGACACTTCCGACACCGAAGA
CCAGATCTCGTTGGCGCTCTTCGCGCAGGTGAAGCAGCTCCGTGAATCCCCCGTGCCGTATTCATCACGAGAGCAGCACATGAGTTGGCTAGAGGCCGCC
CTTGCTGAGAAGGACTGGAAAAAGGCTGACGCGATCGTCCAGCATATCTTCATTCGCGAGCAGAGCCAAGCTGTGACCGAGCGTAAAGCTCGAGAAGAAG
CGGCCATGAATAACAGTATTCCACAGGTTAGCACTATTGATACGACTGCGAGTACGTGGATTGAGTGCCAAGACGAAAGCAGCGGCGCCACGTACTACTA
CAACCAGGCTACAGGCGAGACAAGCTGGAGTAAACCATCAACAGCGTCCACATGGGAAGCGATGCTGGGTAACGACGGGAAAACTTACTACTACAACTCA
ATGACAGGCGATACGGCGTGGGAGCAACCGACATGAATATGAACATGAACTGTACTGTATTAGCCCACAACTATCACCACACTTTGACTCATGCCTCGAG
CCCACCAACGCAGACCATCTTCGTCTCCTGGTATTCCTCGAGGCCCAGGAACGAGCCCTCGCGTCCCAGTCCGGACTGCTTCACACCGCCAAACGGAGCC
TGAACGTTTGAGATCACGCCCGTGTTCACGCCGATCATTCCGCAGTCCAGCGCAGCAGCCACACGCCACGTCCGCGACAGGTTCTGGGAGAAGAAATACC
CGGCAAGACCGGCCTCCGTGCCGTTGGCCATCTCGATCACCTCCTCCTCCGTCGTGAACTTGAACAGCGGCACAACAGGGCCGAAAATCTCCTCCGACCA
CACACGCATTGTGTTGTCTACATGGGCCAGCACTGTAGCCTCGTAGAAGTTGCGGCCGATGTCGCTGCGCTTGCCGCCGACAAGAGCAGTGGCGCCGTTC
GTGACAGCGTCCTCCACCAGCTCCGACGTCTTGAGGAAGGCGTTGGGGCCAATGAGCGGGCCGAGGTTCACGCCTTCCTCGCGGGGCGGGCCCATCTTGA
GCTTCTTGACGCGCTCCACGAGCTTGGCCGCGAACTCGTCGTAGATGCTGGCGTGGATGAAGATGCGGTTGCTGCACACGCACGTCTGGCCGGTGTTGCG
GAACTTGGAGGCCATGAGGCCGTCCAGAGCCTTGTCCAGGTCGGCGTCTTCGAACACAATGAAGGGCGCGTTGCCGCCGAGCTCGAGCGACACGCGCTTG
ACCGTCTCGGCCGACTGCGCCATCAGCAGCTTGCCGACGCGCGTGGAGCCCGTGAACGAGATCTTGCGAACGTCGTGGCTGCTGGTCAGCGCGCCGCCCA
CCTCGGCGGCCTTGTCGTTGGGCGACGGCACCACGTTGATGACGCCCGCGGGGATGCCCACGTCCTCCGCCAGCTTGGCCAGCGCCAGCGCCGACAGCGG
CGTCTCGGCCGCGGGCTTGACCACCGCCGTGCAGCCAGCGGCCAGGCACGGGCCCAGCTTGCGCGTGATCATGGCGAGCGGGAAGTTCCAGGGCGTGACG
ATGCCGCAGACGCCCACGGGCTCCTTGATGGCCATGATCTTGTGGTCGGGCGCCGACGTGGAGGGCAGGAAGCCGTTCGAGTGCATGATCTCGTGCGCGT
AGAAGTCGATGAAGCCGGCGGCGTAGGCCACCTCGCCCTTGGCCTCGGGCAGTGGCTTGCCGCTCTCCACGGACGCGATGACGGCCAGGTCCTCCGTGTT
GGCCACGATGGCGGCGTGCCACTTCTTGAGCAGCACGGAGCGCGCGGCGGGCGTGGTCTTGCGCCACTTCTTCTGGGCCGCCAGCGCCGCGGCGATGGCC
TCGTTCGTCTCGACGCGGCCCATGTTGGCCACGCGCGCGATCTCCTTGTCCGTGGAAGGGTCGACCACGGCGAAGTGCTTGTTGGAGTGGGCCTCGACCC
ACTTGCCGTTGATGAAGCCGGCCGACTGGATCAGCTCCTTGTTGTGCACCTCGGCGTGGAAGAAGCGGCGCGTGGCCGAGGCCGCGGACGGCAGCACGGA
GCGGTGGATCTTGGACGACAGCATGGCGGCGGCTTGGGCTCGGCGAGGCGGAATCGGAAGTGAGCCTGGCTTTTCGATGTTGAAGGACCGCTGG