Description :
From Genome Similarity Track
Location :
Scaffold_776:4547- 9270
Transcript NameFunction/comments
Phymu_g11932hypothetical protein PHYSODRAFT_323276

Sequence
4723 bases(100 bases per row)
AAGAAACACTTAAATCCTGAAAACAGCTCAGTAAAGTTTGCATGCGAGAGACGAACAGAGTATCCATGACGCGCGATACGAACTGCCTCCAGCACGCCAA
CAGAGCGCATTTGCTCGACCATTCGTTCGCGATCGAAAATGCCAGGCTTCTTCACCTCATTGGGCTTCAGGCAACGAACATAGTGAGCTTCGGTGCGTCC
AATCTGAACAATAAGACGGTCTAGCTGACTTTTAAACTGCGCTGATACGCTAGGTGCGCGTAGCATCGAGTAACGTCTCCGTCCGGCCGTTCCGTTTTCA
TCTGGCGAGTCAACATTCTCATCAGCTCCAATAGCCACCACCACTTCATTATCCGAAGACGAAAGGATGTTGCTCGCGTCGGTGGGTAATGCGTCCGTAT
TCTTCTCGACAAACTGCTCCACATTGTAGCACACACGGCCAGCAAAGTGGTGAACCACGAACTGGTGTTCCACGCGCTCCATCTTGGACGCCGAAAATGG
GTGTTTCTTGGTATCATGGTgcacagcttcttcttgagaTTCACTTCGGTGCAAGTACCGGCTGAAGGAAGACATGAACAGTGGTAGAGTGTTCTGAGca
agctgtggctgctgaagcagtcCTGCCGAGTCCGGAGAACCCTCCGCGCCGTGATAGCGGTAAAACTTGGTGCTTAAAGCTTGGTTTGAACCCTTCGGCA
TCAAACATTCCTGATCCAGCAATGAAAACAGACCGTTGCTTTTGTCATCGAAAAGAGTCAAACACGCCGCGTTACTTGGGTACGAGATGTTCCTCCAGTC
AATCCCCTCTGCAATATATACCTGCTGCTCGCGCACAAAAACGAACTCGTTGAACTGTGCTTGAAGTCGCTCGTTGGCGTAGTTGATGCAGAGCTGCTCA
AATCCATTGCGGTTCAAGCTCTCAAAGCCAAAGATATCCAAAATACCAATACTAGCCAattcttcgtcttcgtccgaaATCGAAATGGCCGAGTCGTAAT
AATTGATTTCGTCACTGAGCCGACGTACAAGCCATGTAAAAAGACGACCGTAGATAGCCTTAGCAAGTGATCGGCAGATTTCCTTGGCCTGTTCCGGATT
GTGTTTGAGTTCCATAACCTCCATACCAGCCTTGATCTCTCTGCTACTCAACAACTTTTCAAGCTTGGTCACATCCACACCGATGAGCTCAGCACATTTT
TCCAAATGAAAGCGGGACGCAGCCGTAACAGCAGTGGCATCTTCCTGCCCGCCAGCAGCGGTAAAGTTCACGTTTCCAAGATGTAGCAACGCTGCCAAAA
TCTTGAAAATATCCAGCCGTTCCTGCTCGCCAACGCCCGTGTCCTCGAACGCTCGAACTGTTTCCACGTACAATTGCGCATACTTATCTGCCACAGCCCG
TTTCCGCGCAAAACTGGGTCCGTACGAGTTGAGCAGCTCATATTTGCCTCCTTTCCGGAGTCCCAGCGTGTCtagcagctccttgtctgctccttcgagc
agctcatAGAAAATGTGGAAACTGCGTTCCTCCGGGttctggtgcagcagcctcaccttctccagcaaatAGCTCACGATCTGTGCCCCGACAATCTCGT
TCTTTTCTCCGAACTGGATTTTGATAAATTTGCCAAAGCGACTCGAATTGTCGTTCCTGATAGTCTGTGCGTTGCCAAAAGATTCCAAAATCGGGTTGGT
TTGCAGGATCCGCCTGCCAATTTCCACGGCGCCGCTTCCTTCCTGCTCTGTTTGCGACTGATCTCTGCCCACACTGGTCAAAAACTGCATGAGGAACTTG
GTGCTCTCGGttttgccactgccactCTCTCCACTGACCAAGATGCTCTGATTGCGTCGTTCGGGCTTCAACAAGCCACCGAAAGCTTTGCCACCGATGG
CATACACGTGTGGCGGCAACTCTTCTCTCGCGGATGAGCTTGGGTTTGTCATAACCTGTTTATACGCGTTTAATTGCGCCTCCGAGTACAGCTTTGGGAG
TGGTTTCAGCGGGTTCAAGGCCACGAGAATGTCCCCAATGGAAGTGTAAATCTTGTCGTGATCGAAGCGCTCGCTTAGCGCCTGTAGCAACGCGGCTTCG
TGAAGGTGCTCGAGGCTCGTAAGGCTCGACATGGCAGGGAAGTTGGCTGACATGTTGCGCAGACACAACTCGTTGTCAGAGCCCGGATAGCGGCCTGAGG
TGGCAAAAGAGATTGTTAGTCGCGGAGAGACACTTTCGCGCCCTTTGCCAACCAGTTAGGCTAGTGTTAACGCGACAGGGCGGCCACAttagaagaaaaa
aaaaaggaaGCAAAAACACTTACGCATGACGACGTCGCCCGTGTCGAAACGCCGCACCTGCACTAGGCCACCTGCATCCTGGTAGTCGACCACTTCGCCT
GCAGCCCAGACGGCAGCGTCCTTGGTCTTGACCCACACGTTGGTGCCCACGTCCATTGCGGCCGGGGCCGAAGGGCAAGTGGCGATCTGGTTCTTCGCGG
GTTGTGGGCTGCCGCTTGGTCTCGCAAATGAGTTTCGCCTCCGTCCCAGTTAAACCACACGCCTTCCTTCCCTCTTGTTTTTTGCCTGTGTGATGGACGG
AAGAAGGGAAGGCTCAGTTTTTTTTCCGCCCACAAGAAGGGAAGGTGTATATATAGGGATTTGTATTGCCTCACATAAACGGGACACGTATCAAAAACTT
TTCGGGACGACAGCGCGTCGTTGAAGGCGCCGCCGCACTTCCAGCACTAGTGGAGTTGCGCCTGCGACGATGTAGAGGGCGAGACGATGGCAGTTTGCGA
CGGTGGACCTCAACTGACTTGCCCGAAATTTTGTGCAACGATTGATTCTTTCGCACCGAATGGCTGAACGAGCCAGCACTGCCAAAAAGCGTGTGCTGCT
TGCCGCGCAAGCGTAAAATAGCGTGGTCTTATGCGGATCCGCTGACAATTGGCACGCGGCATgcttggcgatgaagacgaataCATCATGGCAGCGGTAC
GGGACACAGCCTGCTGGAAAAGTCGTACGGTTACCATACGACTTTTCCAGCAGATACTATAGTTACTATGGTATCTACTGGAGATGGCGATCTTCTCACG
CCGAAAAACGGTATGCTTGAAGTGTATGAAGTGTCGAGGAACATTCACGGGTGTAACGCCGATATACACGTACGAAGATACTTTTACACGTACAAAATAT
CGATCGTCGAAGGGAATCGCCAAGATATCATCTGCCGATATTTTGTTAGCTAACGTATACTTCTGAGGAAGCCATGGACATTGAAGACTGTCACTGTCAT
GCGAGCCACAACATTATTGGCCAGGTGGACACAGAGCAGGAACATCCTTGAGGTCGAAGCGAACGAAAACTGGTTTCATTTTTTTAAACTTGGTTTGAAA
AAATGTTCACTGCTGAGAAAAGTACGATAGCCGCATCTTGCTGGCTTGGGGCTCGGCTTGCACCTGCGCAGGGCAGTTCGTGTCTGGCCACTGCGCTGCT
AAGTGGATGATTTGCGAGTTCGcttctgcaggagctggatTCAAGCCAGGCACAAGGGTTGTCTACAACTTGTCGGAAAACACTTTTCTATAGGAAAAGC
TGCTTTTGTTCTTAAAAAAATAACATTTAATTTCGCTTTTTTAAGCAGGTGTCAATACAAGCAAAAATTGATTAAAAATTTGAACAATAATTGCACCTGA
GACTTCTCGCCTTTTTTACGGGAAAAATATATTTGTGTTACGAGCCACAGATGATCCTGTTCATTTCCCTCATTTGTATTTACTCGTTTCTCCTGCTTGC
TAGACTACAAATTACTAACTAACGTTGCTTGTTTTCCCGTGCATGCTTCAACGTGGCTCTCAAATCTTGTACAACATGGATCATCAACACGCACCTGGGT
TGGTTACTGGACTGGGGTCACAGCGATGCTATGATCGAACAGCCTGCGCTTTGCTGTGGTTGTGATTGGAATGGCTCGTGTGGCCAGATGTACtgagcaa
gcagctcagcgcCGACGGTGTGAACTTGGTCGCACGAAAATACTTCAGCGCATAGTACGAGTCCTCGAACAGCGCTACCACCTTGGAAAACGcaaagctg
caggcgctcaCGTTGCGGTCCGGGTGGATTGGGTCTTCAATCACCAGCGCAGGCTTACCGATGTGTGTGCGGTGGTTATCTGCGAGTCTGTAGATGTATC
CTCCGTCGCGCACAGACAGCCCGTTCATGCGGTAGTCGAAGATGATGCCAAAGAACTCGAGAATCATCAaaaggtgctggccaagcgACGCAGGGGGCTG
TTGAGGCTGTGtctcgtcatcgctgtctGTTGAGGAGGAATGGCTGCACGATGAGCTCGAGTCTTCTGTGTCTGCGTTGCTACTTGACACACTGATCGAG
TCCAGTGAGTGTCCATCctggttctgcttcttggttGATGCAACACCTTTTCGTTTTGCTGCAGAGGACGATGAtcctgctggtgctgacactgctgctg
cgtagCTGGACGGTGGCCCTACagggttcttcttctcagATACCTTGGCGATCCCTGCTGCAACCGCGGCGTAGCTGAATCGCGGTTCAGAAGGTGAAGA
ATCTTCCGTgccctgcttcttcgccacaATTGCTGCATAAGATGAGGTCGGAGCAGACAACGGCAACGAAGTCGACTTCTTCAGTGCAATCTTAGCACCA
ATGGAAGACTGAGCTTTGCTAGA