Description :
From Genome Similarity Track
Location :
scaffold_23:454658- 457869
Transcript NameFunction/comments
Plaha_PHALS_05929adp-ribosylation factor-like protein 13b isoform x1
Plaha_PHALS_05930dnaj homolog subfamily c member 21-like

Sequence
3211 bases(100 bases per row)
TTTGATATACTGTTATGAGTGCCCGGAAGCTGCGCGAAGCGATAAAAACAACACCTCGAGGTAATTGCCCAGGATTTGATCATCGATGTTAAGTTTGTCA
ACCTTACAACAAAGTATTACGTACTCgaagcttttgaaaatgaGCACGAGTATCTTCGACAATATGTAGATCCAGTCCTGATGCCACTCATTGAGTCGCT
TTTGCTTTATCAACCAGAAAGCGTCTATCATTTTATCCACGACTTTGTAGACGAGAGCAAGAGTACCCGCTTCACACACCGTTCCAAGAGTGTAGGCTAC
GCCAAGAAGCTCACCACTCGCCGCAGGATGGCGGATTTTATGTCAACCAGCGTAATTCCTATCATGGATGATCTGGCCAAACAAATACTACGCGAGAAGC
CATACTCCGTCAAAGGTGAGACCAAAAGATTGCATTAGCTTGTAAAGTATTCCTTATCATTTTACTAGAATTTATACGAGAGATAGTTGCGGCACGTATT
TTCGTTGAGCTGAAAGAAACTTCAAAAGATATGTCAAATCGACTTACAGCCACTTTGTTTAATGTAAACGACCGCGTCTTGTGTCGGTTTAAAGGTCGAC
CACGATATTTACCCGCCGTTATCACTGAAGTTAATGAGAATGGCAATTTTACAGTCTTGTACGATGATGGAAAGTTGGAAAGCAATGTTCATTCAATGTG
CCTAAAACAGTGCATCAATGACACAATAAAAGACGCAGACAATCAAGAAATACCGAAAGCCACTCGCTTAATAGATATGGTACTTCTGATTATTGGAGTC
GACGGGGCTGGCAAGACGACACTGTTATCCACTTTGCAAGGAGATTTGGAGAAAGAACATGTGCCAAGTGCTGGCTTTACCTCGGTAACATTTCAGACAG
AGACAGGGTCGGCTACTTTCTTTGATCTTGGAGGCGGTCCAGCGTTTCGCAACGTGTGGAAGGAATATTATGCTGACGTATGTATTGCTAAATTGAAGCT
ATTCTATGTAAATTCTGATTTAAACTTACACTTTGATTTTGCTCAGGCTCACGGTGTGATATTTGTCGTTGATTCATCGAGTGAGAGCTCTGTGCTTCAG
GCAGCAAATGTGCTCGAAGCCGCAATGACAAATGAGCTTATGATTAACAAGCCGTTGCTCGTGTACGTGCCTCCGTTGCTGTTGTCCTATGATAGTAATT
TACGTTCGGTTTTGCATAGTTTCGCCAATAAACAAGATCTTGCTGATGCAATAGCAGAGTCAAAGATGGGAGATATACTGCGTATAAGCAAATCATTCAA
TTCCAAGATCGTTCCGTGTGTAGCCAAACCAGCAGTGTACGGTCGAGTAGACGAACGATTGGAAGCAGGACTTCAGTGGCTTTTCAACCAAGTTCACAAA
GACTATGATAGTTTATTCGAGCGTGTCCAAAGGgatcttgctcaaaaaaaAAAGCTCGATAAACAGCGACGGAAAGAACAGCGCGCGCGGGTTACACGTT
GGAAAGAAGAACGTGAGCTTAGCCAGATGTGTATGCACGACAAAGTGATTTTGGGCGAGGACCACGTTTTGTCGTTTATACCGGTTGTCGAAATGCctga
agacgacgtcataTACTGCTCAAACTGCAGCACGGTACCAGCAGTAACAAAGTGCTCAGCGTCGAAATGGATGCCTGTTTGCGAGACCTGTGCAACCAGC
CTTAAGAAGCAATGTACGTTACGTGAAGTGTGAACCATCCTTTAACATGACAATATCTTTGATTCAATTTCGCATTTTTCCTTTTTTGCAACGACTTCGT
TGACCCTCTAACTCATCTTGAGCTTTTTTTATGCAAGCATTGGttataatttttttgacgTTCTCTTTTTTCTTATTCTTGCGCATATCTTTGCGTTCCC
GGCGTTTTTCGGCTGCCCTGTGCTCTTTTTCGAGCCTTAATTGCTCAGCCTCTGCCATCTTTCGCACTGCTTCCTCATGATCTTTGATCTTCTCAGAATC
GATACCGTCGCGGTTATGTTTGATTTCGTCTGGTATGGGCTCCGTAACAAAAGTTTCATCGATATTTAAATCAAGCTTTGCTTGTTGAAGATCTTCTTGC
AAAGATTTGTCCATTTCCTCGTCATTTATGCTAAATTTGCAAAACACGCCAAGattctcctctttctcacgGTGTTTCTTCGATACAAGGTGGTTTTGCA
ACTGTTTCGTGGACTTGAACGTCTTACTGCACAAATCACATATCAGCACGCTCTTATCCAGTTTCATTCGACGCTTTTCGAGCTCTAACATAATATCTCG
GTCAGCAAGTCGACTAGTATCCATTCTACTGGCAGCCCACAGCTCTTCCTGTTGCTCCTGAAAAGCACGACGCTCGGACTCGAAAGCAAGCTGCTTTTCA
CGTTTCCTGGCCTCTTCATTGAGACGTCTTTGCTCCTTATCCCGATCCTTTTGCATTTGAAAGTCTCGCACACGCGGGTCACGCCGATATACAAAATCTA
CGAGTTCGCGCACTTCCGTTACAAACGCCTTCTTTACAGTCTCCCGCAACTTCTTGTTCTCCTTCTCCATTGCTCGCCTTATTAGTCGCGTTGGTGCATC
GGTCGTCTTGTATTCGTCCGCCCACGCAAAGCTTCGCTGTGTCGTATAGCACTTCCAGTACTGGTAGAAGTAACTAATAGCTCCCATTGACGATTCAGCA
TTTCCGAATTCGGGTGCAGCtccggatcgcaattcatcGTCTACTGCCATATCCAGTCCATCAATCTGATCAAAAATAAATCCGTTTTAACCATCGTTTT
GTTTGTAAAATGCTAAGTCGACGAAAGGTGCACCTTTTTGAAGAGTTCCCCGTACACTGTGAAAAAGCTCTTGCTATCTGAACCAAAGCCTGAATAGACG
GAAGCGTTGAAGTAACGGATAATATTGAACTGACTTTCGCTCTCTTCGTTACTGTTAGCTTCTCCGCTCTGTAGAATCTGCTCGCGGTGTTCGTCATACC
ATTTCTTCTCGTGTGGGTCACTGAGCACCTCGTAGGCGTTTTGTATGGTCTGAAAGTGTTTCGTGGCCTCTTCGCTTGTGATTCCGTTTTTCTGGTGCTT
GTCTGGATGCCAGCGCAATGCCTGGCGACGAAAAGACAATTTTATCTCGGCTGCTGATGCATCACGCCCAATGGCCAGCACCTCGTAGTGGCAAAGCATC
CAGTAAAAAAT