Description :
From Genome Similarity Track
Location :
Scaffold_677:4546- 6208
Transcript NameFunction/comments
g12840.t1hypothetical protein

Sequence
1662 bases(100 bases per row)
CCCTCAGCCTGTTTCTCGCCAGGCATTTTCTCTTCTTGACCAAAGAAGCGCCGTGTTCATCCTGAGAGCTGTGCGCGACTGGCCCGACTCTGAAGGCTAC
CTGCATGCTTCAATCGCGACAACTGGAGCGTCTCACCCTTCACAACCTTCACCGTGAAGTTCACGGTCTTCTCTGTAGACGCAGCCAGAAGGTAAAGACG
AGTGGTGGTTGACGTGTACTAACGAGCGGCTCGTCAAAGCCGGACGCAGGTCTGTTGGCTGGTTTAGCGACTGGTGTAGCCCTTGCGTCGTCAGCCAAAG
CGTCTCCAACTTTCTCGTCATTCTTCGATTCGCGTCAGGTCCCAGCATCCCCCATGGAGAGCAAACCCACCTTCATGCAGAACATCCTGCGCACCAAGCC
GCTGGCGGTCATCAAGGCCGAGGAAGCGGCCGAGGAGCTACCCCGCCAAATGGGTCTTTTCGACTTGCTGTGCATTGGAATCAGTGCGTCCGTCGGCAGC
GGCATCTTCTCCACGACTGGCGAGATCATCTCGGGCACCGCGGGTCCGGCTGCGTTCGTGAGCTGGATCATCGCCGGTGTCGTGTGCTGCATCAACGCTC
TCGCCTACATGGAGATGGTGACTCAAGTGCCGTCTTCGGGAAGCACCTACGCCTACTCGTTCTACGCTCTTGGCGAGCTCCCCGCGGTGGTCGCAGCGTG
GCTGGTCTCACTCGAGTACGGCGTGTCGGGATCAGGTGTGGCTCGCAGCTGGGCGACGAAGGTGCAGGAATGGCTCGAAGAGGAACACCCCACCCACTCC
TACCAGTGGCTGAACGAGGACTACACGAACCTGCTGGGTGCCGTGCTGATGGTCCTCTGCGTGATTGTGCTGCTCATGGGCATTCGCTTCAGCAAGTGGT
TCATCAACGTCTTCACGACCATCAAGGTGCTTGTGGTCATGTTCATCATCGTCGCCGGCTTTGCCTACATCGACGCAGACAACCTTTCGCCGTTCGTGCC
CGAGCGCCACAGTGTTGACGGCGCCATGGCGTTCGGTGCCCAGGGTATTATCACGGGTGCGTCGTCGGCCTTCTTCGGATACGTCGGCTTTGATGAGGTG
TGCTGTCTGGCTGCAGAGGCCAAGAACCCCAAGAAGATCATGCCGTTGGCTGTCATCGGTGTCGTCTTGGGTATCATGTTCCTGTCCTCCTTCGCATCGC
TGGCGCTATCCGGATTGGTTCCGTACAGCAAGGCTACGAGCTTTGGCGCTGGCTTCGACTACGCGGGGCAAAACTGGGCGGCGCAGATCGTCCGCGCTGG
AGAGACGTGCACCATGCCGCTGGTGGTACTGGTGAGTTTCCTGGCGCAGCCGCGTCTGAACTACGCGCTGTCGTGCGATGGCCTGATGCCTCGTATCTTC
GCCAAAGTCGACGAGAAGGGAAACCTGTTCGAGAACACCCTCATCACGGGTGTTGTGTTCACGGTCGTGGCCTTCCTGATACCTTTCGACACGCTGTGGG
ATGTCGTCAGCTTCGGCATCTTGCTGTCTTTCAACATGACCAACTCGTCGCTGCTCATGACGCGCATGCGCCGTCAGTCGCCTACGCTGGCGCCGAAACT
CATCGGACTCATGGTGGGGTCCGCGTGGTTGGCTGCCTTCTTCTACCAGATCGGCTATTCGA