Description :
From Genome Similarity Track
Location :
Scaffold_105:45446- 48215
Transcript NameFunction/comments
Physo_141903hypothetical protein

Sequence
2769 bases(100 bases per row)
GAGCCTCCGCCCTTGAGCATGTTGCCGCCCTTGCGCACTTGCTGGTTGAACGTGGCGTTCTGCTCCTCGAGCCAGCGGCGGATCTCCTTCTGCTTCTCCT
CCTTGGCCGCGAGGCGCGCCTCCTCCTCCTTCTGCTTCTCGCGGTGGATGAACTCGGCGTCGCGACGCAGCTCGCGGGCCGCGCCCTTGCGCGCGCGCTT
GACTTGGCGCTGCAGCTGCTTGAGCTGCGCAGTGTCCTTGGGCGCCGTCTTGTCCTTGCGGACCGTGTAGTTCTCGTCGAAGAGCGGCGCGAACGTTGGC
AGCGTCGTCGGCGCGAAGCTCTGCAGACGTAGCGGACGACGCGCGTTCCAGCACGAGTCGAGACGCTTGTGCAGCTTGGAGATGACGGCGTTCACCTCCG
AGATCTTGATGTCCTCCAGCTGAGTCACCAGCGCGTGCAGCAGCAGGTACTGAGGGTAGAACAGCTCATCGAACGACGGCAGCGACGCGTACTGCGCCGA
CGTGGCGTCCAGCAGAGCCAGCAGCGAGCTCAACACTTGAGCGCCGCTGCAAGACGAGCTGCCAGCCAGCGACAGACGCGGCAGAGCGGGCATCTTCTTC
TCCTCAGAGTGTGCAGCCACCCATTCGAGCAAATCACGACGCAGCCAGTGGACCGAGGACTCGCTGTCGTCTTCGTCGTCGGCTTCCTTCGTCTCACTAG
CACCCGACGTCACGAACGCGCGGAGGATGCGAGTGAGGAAGGTCACGACCTCCGGCATAAAGCGCTCCTTCGACCGCGTCATGTCCAGTGACAGCGAGGC
AGCGAACAGCGCCTGAGTGGCCTCCTGCGGGGAGCTCACAGCACCGCGAGCCAGACTCTCGCCCAGAAGCGTCTCCATGGGAGACACCACGTTGTGCCGC
AAGTCGGAGGTCGGGAAGATGGACGTAAGCACCTTAAAAAGAAGCAGCTCCGGTAGCGACGGCCACGCCGAGGTCGAAGCGCGCTTGCGCAACCGCTTGA
AGAGCTGAGCAAGCAGCTCACGCACCACGACACCGGCAGTGTCACCCATCTGCTGCGCCAGCGTGTACATGTTCCTCGCCAGCGAGTCGAGCTGTAACAA
GCAGTGTAAAAAGTTAGCATCAAGACATGCATAAAGCTGCTGGCAAGAGTAAAACAACGTACGTCTTCCTTGTGTGCTGCGTAGCGCGCCGCGAAGATAA
GGAACTGGCGCACCATCACCGCGAAGAAGCGCTTCATCTTGTTCTTGTTCTCAACGCTCAGGCGCGGGTTGTAGTACGTGACAATGCGGTCCAAGATGAG
TCCGCGCTTCTCGGGCGAGTTGCGCGCGTGCTCCTTGAAGAGCGCCGCGAGCTCCTCAGGGGACTCCGGGCACTCGAACACGAAGGGCAGCTCGGCGGCA
GCATCCTCAGCATCCTGCTTCCGCTTCTGCTTCTCAGTCTCCTCGTCGCTCTCTTCTTCGTCCTCCTCCTCTTCGTCTTCCTTCTCTTCCTTGTCCTTCT
TCTCCTCAACCTCGTCTTCGTCGTCCGAATCCGCTTCCGAGTCGGCCTCCGAGTCCTCCTCCTCGCTCTCCTCCTGTTCCTCCTCATCCTCGTCACCCTC
CTCAGCATCCACGTCGGCCTCTTCCTCCTCCGCGTCAGCATTGAAGCGCGAGTCCACAGCATAGCCGTCCGTCAGGTCGTCATCCGTTGGCGGCATGATG
ATAAGCTTGGGTCCCTTGTCCTTCTTCCCCTTCTTGCCCTTCTTGCCCTTGCGCTTGCCCTCGTCCTCACTGTCGCTGTCATCGTCGTCAGCGCCGTGCA
TACGCGCCACACGCTTCTTCTCCAGGGCCGCAAGACGGTCGCGCTCCTTGGCCGCAGCCTCCTCGGGCGACATCCTGCGCTCCGTGGCCTTGGCCTTGGC
TTCGAAGGCGAACTCCCTCGTCAGCTTGTCGAAGTCGTCCATCGGCTCCTTCGGCAGCAGCTCCTTGCCGTTGGCGCGCGTGGGCCGGAACTCGAGCAGT
CCGCGCAGGTCGGCGAAGCCCTCGTCGAGCTTGTCCGTCTCGTCCTCCTGCGCCGTCTTGTTCTTCTGGCGCTCGGCCTTGAACATCTTGGCCTTCATCA
TGACCTCCTGCATGACCTCCTTGTGGGTCTTCCTCTTGCCGTCCTCTGCCTCCGGCGCGGAGGCGTCGGCGTCGCCCTTGCCGCCGCCGAAGTGCAGCTT
GTTGACGATGTCCCTGTCCATCTTCCTGCTCTCCTCCGAGTCGTCCTCCTCGTCCAGCGGTCCGTCCGCGTTCAGGCGGTCGTAGTCGTCGTCCGTGATC
TTGGCGCCTTTGTGCGTCAGGAACAGCGCGTCGTCGTCGCCCTCCTGCTCCGAGTCCGAGTCGTGCAGCGCGAAGGCCGCGGCGTTGCGCAGCTTGCGCT
TGCGCTCCGTTTGGAAGCGCGCCATCATCTTGTCCTCCATGGACAGCGTCGGGTCCTGCTCGCCGAGCCGCCGGTCCTTGAACACGTTGCTCTTGTTGCG
CGCCTTGAACTCGGCGCCCAGCGTCTTGCGGCGCTTGCGCTCGGCCTCGGCGCGCGCGGCCGCCACGTTGCGGCCCGCGCCCTTGACGCGCCGGCCCAGC
ACCTCGTGCTTCTGCTTGCTGGCGTTGCCGCGCACGTCGAACGGGTTGGCGCCGCGCGAGCTGCTGGCGCGCACGAAGCCGTGCTTCTGCTTCTTGGCAC
CACCGCCCGCGGCCGCCTTCTTGCCGCCGCCCTTCTTCTTGAACGCCATGGTGGGAGGAGGAGATGCAG