Description :
From Genome Similarity Track
Location :
Scaffold_194:45444- 47025
Transcript NameFunction/comments
Physo_144530hypothetical protein

Sequence
1581 bases(100 bases per row)
GAAGCGGTCTCCGATGCGTGTGGACACCACCTCGTGCATCTTGACGGAGATCCCCCACTCGGGCTGCTCGAAAGCTCGGAATGGCTTGACCCTGAACTTG
TCCTCGCTCCCAGCACTCCTCGGCGGGAACTGCAGCACTTCTTCCTTGTAGACCGCGAGCGCCGACGCGCTCATGACAATCTGGCCACCGCGTCCCATCT
CGCTCATCTCGCGCGCCATCATCTCGCTAGGCCCGAGGTACGTCATCTTGCCTGTGGTCGGGTGTCGAGAGCACACGAGCCGCTCGTCGCCGTCGTGGAT
GGCCATGCGCACCCGCAGCCCGTTGAACACCAAGCGCGTCCAAATGTCGTACATGCGCGCAGCGTTGTCGTACTTGAGCAGAGCGGCGGGCCACGGCGCC
TTCAAGAGCTTCTCCTGCACGCTGACACACCACCCGATCGCGTCGCGGACGCAATGGAACGCGAGCTGGAAGGAGTCGCCCGCGGTTGTGATCTCGTAGC
CTCGGAAGCGCGGCAGCTGCTGCCGCAGCAGGTCGTCGTGGATCGACTGCGCTTCGGCCATGGCCTGCGCGTTCCCCGCCCACAGTCGACTCGAGCCTTC
AATGTCGGTCACCACGAAGATCGGTCGACGGGTAGGGGCTTCTACGATCACGTCCTGTAGTCCGAGCTCGTCAGGGAAGTAGCCACCTTCGAGGAGCTGC
TCGTACACCGATGACGACATGAGCGGACGCAGTGCGCGGAAGCAGCACGTGACGCTGATGCCGATCGCGAAGGCCGTACCTGCGCCTGAGAGGTAGTATA
GGATCTGCGTGAGCCCCACCCACTCCATCCGGACGCTGTCTACGAGGCGAACCAGCACCTCCACGATACACGACGGGAACACGAGCACGCAGTACACGAT
CACGAACGTCTTGATGCGCTGGTGCAGCAGCAGCGACGCCGGGTCCACTGCACTCCGTGTGCGCTTCTGTCTAGAAATCCACACCGTAGCGTACAGCGGA
TACAGCACAGACACCCAGATACACACCAGCTCGAACCAAAACGCAATGGTTTGCAGCGTCTCCGACTTGGCGGACGGCAGGAAGGCCGATACGATCATTA
GAATGGCGAACACAACGGCCACGATGTACGCGCGCAAGCAGTACTGCCGGATGATGGCGCGCTCGCGCTTGGGGCCTCTGTCCATGGACTTGATGATGAG
GCGCTTCATCTCGTACGCCAGCGTGGTGATGAAGAAGGTCGTGCACAGCAACGCGCAGTCTCCGATCAGCGTCACCGTCACTGCGATGGCTTTGAACTGC
TTCCCGTCCGAGTACACGGCGCGTGCGCTCATGAGTTCTCCATCGTCCAGCGCGTCCAGCAGTCCGTCGAAGTTGATGAGCACGCCCACGTAGAGCAGCA
GTCGCGCCAGCGAGTAGACGAAGTACAGGCGGCAGACCGAGTACGTGATGTACTGCACGGCCGAGTCCCCCACCTTGATGTGCTTGAACGAGAGCAGCAG
CGTCGTGCCCGTCGTGGCCGTGGCCACCGCCAGCACGATCACATAGGTCAGAGTCCAGTCGTAGTGGGTCGAATCATCCAT