Description :
From Genome Similarity Track
Location :
Scaffold_267:45443- 46445
Transcript NameFunction/comments
g12819.t1ETK77616.1 hypothetical protein L915_16139 [Phytophthora parasitica

Sequence
1002 bases(100 bases per row)
GGAGCCTGCTTCGCCAGGGTTGTGAATCACGCCGTACGCCGCGTCAACTTCTTCAACTTCGTCTGCGACTCCAGCAACCTTGGCGGGCTGGTGGCTTTAA
CGACCGCGGCGGACCTGCATGACCCGCAGTGGATTGTGTCGTCGTATCCCCACGGTGCGCTGTTCGTCTACCGCCTGTACGTGGAGCAGAACGGCTAGGA
CTGGGCTGCCGCCATAACTAACCAAAGCGTCAGATTTAAAACCGCGGCGCGCACGTTGCGAACAACCTCGTGACGACCCAAGAGAAGACAAGATCATTGG
TTTGGGCACCAACGCGCGCGTCTGGGGCGCTCAGTGGCGTCACAGGAACACTGCTTGACTCGACCCATATTGGTTGTTTACCTGTCGCAGTTGATTAGAA
TTGTCGGGGGGAGGGGAGATCTAGTGCCAGCACGACGACGAGGTCGCGCGCAACGTTGACACGTACATGAGCGAGGCGCTGACCAGGGCGGCATCGAGCT
CTCGCAACTGCAGGCCATCGGCATCACAAACCAGCGCGAGACGGTGTTTATCTGGGACCGCATGATCAGCAAACCGCTGTGTAACACCATCGTGTTGCAC
GACACGCGCACGACGGAGATTGTGCGCTGCGTTAAGAACGGCGAGGGCGACGGCTTTCTGGCATACGTGCTTCCTTCCACGCAGTCACAAAATCATCTTG
GGAATTTGAAGCTGGCCGTCAATGTTGTACGGTCATACAAAACCTTGTGGGTAGGATAGAATTTCAATAACTATGATTAGCGCCGCGTGTCTGTCGCTAC
ATCAATCAAGCAGAACAGTGTCACGACGTACCGTGATATGATCTGCTTCATCGTTCAGAGCAACGGTGACAGAAGTTAATCAGTAATTGTTGGGTGCCAT
CGGCATAAAATCTTGACGGGAAAGACAGACAACTAGATAAGTAACAGCTGGGGGTTGTTGAAGTTGTTCGCACTAAGAATCGTTGCCTCCCAATCTACGA
TA