Description :
From Genome Similarity Track
Location :
Scaffold_497:4544- 6968
Sequence
2424 bases(100 bases per row)
CGCCGACGCAGAGGTGGCGGGCTTGACGCTACAGCAGACGGTGCAGCTGCTGATGCCCTGCGGAGTCATGGGCACGGCCGCGTACCTGCTCATCCTGGCG
TCGTACTTCGTCGTGCCCAACATCAAGGCGCAACACCCTGCCGCCAACCTCGTCATCTGGCAGGTCGGCTGCGGCCTCATGACGTCGCTCGGGTTTGTGG
CCGCCTATTTCGTCCAGGTATGCGACGTTGCTCGTCATTGATGTCATTGGAGTTATCCACACGAGACACGGAGTGACGAACCTGATCGCTGATGGACGTC
TCGATTCTGCTGTGATGACACTGGTACTCATTAGCTCAACACCGACGAGCGCGATGAGGCTGCCATTCGACGACAGTGCGCGTTTCTGTCACCATACAAC
CAGGTGCGTTACTCGGAGACCAGATCAGGCAGTGTTGCCTTCACCTCACGCTCACAGTGTGTAATAATTGCAGTTCTTCCTGGCCGCAAGCTGCGCTTGG
TATCTCATGCTGACTCTCGACCTGCTTGTGGCACTCGTGAACCCGTGGATGGGATACACTTGCAAGGCGTGGGCGTATCATACCATGTGAGTCTATTGTG
TTGTTGGCGCGAGCTACAGTCGTTCATAGTTGCTGAGCTGCCGTTGTCGACCAGTGTCTGGAGCATAAGCGCTATATCTGCCTTGCTGGTCTACCAGCTT
CGGCTGTACGGTCTGTCCGAGATCAAATTGTGTTGGATCGAGCGCACTCAGTTCCCAGAGCAAGTGAATACCGCGAGCTGGATCTTCCTCTTCGGTCTGG
TGATTGCGACGTGCGCGCTTTCACTGGTGGTACTCCTCTTCGCCAGCTTCCGTTTTGTGCGGCGCCAATTGGATGTCACGTATCGTGCGAAGCGCCGCAA
TTTGATCCAGTACTACCGCTACCTGCTCATCTTTGCGAGCTACTGGGCGGCGTGTGGAGCACTCTACTACTGGTGCTATCACGAGCGTTTCCAAGGCAAG
ATGGCCAAGCACTGTGAGCTAGCGCTCGTGATCGTGTTTGGATTGTCCTACCCAGTGCTGCTATTGCTAGTGTGGGTTTTCAACACAGAGCTGTACCAAA
ACCTCTCGAGCGAAAACACCTTGTTGAAGTCGGAGCGGGGTTATGGAGAATCGACTAACACGGAGCATTTCAGCTCAGCCCTGAGGAAAGACTTGATGCG
GTACACGACTGCAGGCATTCGCGTTAGTCTCAACGAGACGCAACCCGATAGCTTGCGGTCTCCGTTGCTGAGCCAAGTCCAGGGATCGATGGATCGGGGG
ATGGCAGCATCGTTGTCGTTTCTACAGTTGGAGGAAGGCGACTCGGCTGGGCTGTACAGCGAAAAGAAGCGAGTAGCCACGACCGTGTACAACCGGGAGT
TCCGATACTATGAGAAGCTCGGGTTTACTGACTACGCGCCGCAAGTCTTCCGTAACATCCGCGAGGTGTGTGGGGTCGACAATGAGATGTACGAGCAGTC
GTTTGCTGACACGCTGCTGGAGCGCGCATCAGAGGGCAAGTCCGGGTCGCTGTTTTACTTTACGAGTGACCGCAAGTATCTCGTGAAGACCATGACCAAG
AAGGAGCACTCGTTCCTGATGGAAGTCCTGCCGTTGTTCCACCAGTACATCCTCAAGCAGCCGAACACGCTTCTGTGCCGCTTTCTCGGGTGTCATTCAA
TGCAGCTACCTGTCGGCTGGAACAAAATGTTCTTCGTTGTTATGGAGAACGTCTTCTCGGACGGACCTGTCGACGAGCGCTATGACCTCAAGGGCATTTT
TCATCAGACGAAGTTTACGTATCAGGATGGATCCCTGACTCCTCGTTCCAGCGACTGGCGAGATCAGGCGGCCGCAGCCAATTCCGTTGGAGGTGGCGAC
AGCGCGAGTGAAGAGGAGAAACACGGCAGTGACAGCGAAGCGGAAACCGCCTTCCAGGTGAATCGTAACTCCGAGCTGCGAGTTTTGACCGAGAGACAAC
CACTCTTGCGTCGCGGTAGTTCGCGAGCATCATTGCGTTATGAAAACGATTTTGTCACGCGACGGGCATCCCTTCGTGTGACTCCAACGACGCGCGCGAA
CCTACTGGCTCAAGTGACAAGCGACTGTGGTTTCCTTCAAGAGCTCGGCATTATGGACTATAGCTTCCTTCTGGGCGTTCGACACTCTTCAGAGCAGCTA
GATCCAGCAGTACTGGAGCATTTGGCGCACAACGCTGTGGTGTCGACCGACTTGACCAAGGTGTATTACCTCGGGTTTGTCGACATCCTGCAGTACTACA
ACTTTGGGTGGCAGATGCAGCACTGGCTTCTGGCTGCGTTGCTGGACAAGCGGAGGATCACGGCGCTCCCGCCCGCGGAGTACGCGCTGCGGTTTCTGAA
CTTCATCCACGAGTATTTGCTGCG