Description :
From Genome Similarity Track
Location :
contig_15:454325- 455375
Transcript NameFunction/comments
g4063.t1XP_008897447.1 hypothetical protein PPTG_05608 [Phytophthora parasitica INRA-310

Sequence
1050 bases(100 bases per row)
CAGCTCGGGCCGTGCGACCCACGCGGTGGATGTAGTCCTTGCCGTGCGTGGGGATGTCGTAGTTGATGACCACGTCGACGCTGGGGATGTCCAGGCCGCG
CGAGGCCACGTCCGTGCACACCAGCACGTTCCGCGCCTTGGCCTTGAACTTGTTGAGCGCACCGAGGCGGTTAGGCTGCGTCATCTGGCCGTGCAGGCAG
ATGGCCTGGAAGCCCAGGTTGCGCAGCATGAGCGTCACCTTCTGCGTGCCGTTGCACGTGCTGGCGAAGATGAGCACCGACTGGCCGGCCACCTCGTTGA
GCACGTAGGCCAGGTAGCAGTCCTTGAACTTGGCCGGGATGAAGAGGTAGTGCTGCTTGAGCGTCTCGGGCGTCGCGAACTTGTGCGTGATCTCGACCTT
GGCCGGGTCCTTGAGCGACGCGCGCTGCAGCTTGCGCACCTTGGAGGTCATGGTGGCGCTGAAGAGGTACGTGTTGCGCTCGGCCGGCATGAGCTGCACG
ATCTGGTTGATCTCTTCCTCAAAGTCCATGCTCAGCATGCGGTCGGCCTCGTCCAGCACGAGGAACTTCATGGTGCGCAGGCTGAAGCCCTTAGTGTTCT
CCAGGTGGTCCACGAGGCGGCCGGGCGTGGCGATCACCACGTGGGGCTTGCGGGCCAGCGCTACCTGCTGCTGCATCATGTCGATGCCGCCCACAACGCA
CGCGCATTTCAGACCAATGGACGCGCCCAGCGCCTCGAACTGCTCGCCAATCTGATAGGCCAATTCCCGTGTCGGGGCCAGCACCAGCGCGTACAGTCGC
TGCGGGTTCTGCAGCAGGCTCTGCAGGATCGGGATCACGAAGGCGCCCGTCTTGCCCGAGCCCGTCTCGGCCAGGCCGATGAGGTCCTGTCCTGCCAGGC
CGTGCGGAATGGCCTGCTGCTGGATCTTGCTGGGCGCGGTCCAGCCCACGGCCGCGATCGCCTCGCAGATAGCCGAGTCCACGCCCAGCTCCGCGAAGCT
CTTGGAGCCGCTGAAGCCATCGGCCGCCTCGTTGGTCGCGTCGGCCGGGG