Description :
From Genome Similarity Track
Location :
Scaffold_16:45425- 47237
Sequence
1812 bases(100 bases per row)
ATATAGACAGGCATAGTCATAGTTTCAGCTTTTAGCTGGTTAACAATTAAACATAATTCAATGGCTTTTAAGTACACATGTCAACTTCTTGTTCGGGCTG
GATAATTAGCCCCTCGACGTCAAGAAAGTTTCACATACTGAAACCAAGTGATATACCGATATAATGGCTGCGAATAAGAGTTATCAAGACATATCCCAAC
TGCTATCGGACACAGCAACAACGTAAAGGACAAGGTGAAAGATCGCGAGACGGCTCAAGTGGTCAGAAGGTCAAGTGTATCAAGCATCTACGTATTCGAC
AAGGCGATCTTGTTGAAATATGGGTAGCTTATAACAAGCTCCTTACCAGTATACTCGTGACCGTCTGAAGATTTACGCACGATCATTCCAACCCCTATCC
CAAACACGGTCAAGTTTTCCCTCGACACGATTCCACCGAGAAGAGTGCAGCCCGCCCTATTGACCGGTACAAAAGGTGAGGAAGAAATCAAGCACAGAAA
CAAAGTACCCCTCCAATAGTCGGACGTCTGGGCGCCAGTAGAGAATCAGTATCGCATCTGAAAACGAGCGGTCCCCGCTCCACACACTTACAAGAGCGAC
ACGGTGTGATCGGAGGGCTATGTACCAAGCAGATCGTTCTTCTACGCCCAGATCAGCGTGCTGCTGATGCTTTCTCTCCTTCAAATGAAAGAAACCATTC
AGACAGGCGGTCGTCCATTGCTGCGTGTCGCCCTTCCTGATTCCGCTTTGAATCCGGATTGATGCTGTTGTATAGCGCGCTGTTTTGATAATATTACTTT
TGCTCAAGCGCTTAACACGCCGCCCCCACTCGATGTACGTTCAGTCGCTTAGTTTTCGCTGGGTGAGGTCATATAGCAGCATAATGTGCGCGGAGTTGGT
TTTTCTTTCGGGCTGTAAACAAGCACGCGCTCTTGGCATCGTTATTGCTAGTAATGACTGGGAGAATGCCAAAGTTCCTGGAGACGTTGATCCGGTCTAG
ATATTGAGCTTGTATTCTTATGGTATACAAACGTAAGTTAGGTCAAAACTACTTGATCTTCGTATCTGTCGTTTTGGCCAGGCGTTGCGTGTGACTAAGC
TGTGATTGTGACACATGAGTGCGTGCGAAATATAGTACTTTGTTATGTACAATAGTAAATAGTGAGAAGAGATATTTGTATGTGAGGCCCCCTGCGCTCT
GCTAAATCGCGACAGTAAACACAAATATAGTGTCTTGACCAACAAATTACACCACATACAAAATAGCACCCGCAGATTCGTAAAACGAGCTGATAAGTAT
TGAAAGGTCGAGTTCTAGATGTTTGGCAAAATGCAAAGTGAATGTATTTAGGTCATTAGTTCCTAAACTCTTTTGCTACTCTAAGCCTACTGGATTCTTC
AACTGCACATTCGTAATCGCTATGTCGTGCATTACTAATCTTACAGTCGCGTACTAGTAATAGCACATCGCACATTACAAAATCGTACAGTCGCGCATTA
CTAATCGTCTAAACGTACCGTTCGGTTCCCACTCTCTGGCCAAGGCGTCTTCTCTTCAACACTTCCACTCGACTCGGTCGCGCTTGGTGGCTTGATCCCC
AACTTGTTTCGGAGACCTTCAAACTGCACCGCGCTAATTGGATTAGTCATCAAGTCGTTCTTCATGTCCTTATTTGAACGGTATTGCAGCACCACTTGAC
CGTCTTCAACCTTCCCCCGCACGAAGTGATAGCGAATATCAATGTGCTTGGTACGCTTGTGGCACTCCGGATTCTTGGCCAACGCTATCTATCCTTGATT
GTCTTCATGAAT