Description :
From Genome Similarity Track
Location :
scaffold_38:45424- 58616
Transcript NameFunction/comments
g12664.t1 hypothetical protein PHYSODRAFT_293883
g12665.t1 hypothetical protein PHYSODRAFT_537011
g12666.t1 hypothetical protein PHYSODRAFT_353509
g12667.t1hypothetical protein
g12668.t1hypothetical protein

Sequence
13192 bases(100 bases per row)
TCATTGCCCTCCAAGCACCATTGTGATGCGCTCCGGACGTCGCTTCGTGCCGGTGCGGAAGTGAAGATGCTCTGCCGCATTTACCCGTGTGTACACACTG
TGGTAACGATGTTGCCGAGGACACGAGGCCTTCGGTCTGTGCTGTATATAGTCTGCTTTGCACCTACAAATGTTTCCAATATAGGTAACGAAAGAGCTCT
TCATATAAATGAATGCTGAAAAGAGTCGATACATGTAGTCATAGAGAATCTGTGTCCAGGCGAGCTGAAGCAGAGATTCGTCAACTGTCTCCGAGTAGAT
GAGCCGATTAGAATGTATTTTCGCCCCAGCGAGCTCACGTTTGAGCCCAGTTACAGCTCGCAACGGCGAGCATTTGTCAAAATCTAGGGTGATCAACCCC
ACCTTCAGCAATTCAGCTCGGACTTACTGTAGAAAGGGTTTTCACCACTCGCAGTGATCCATTTACTGCAGCATCTTTGCCGACATTGCTCAAAACGTGT
TGGATCCAGGTCAGTCTATGGATAGACCCAACCAGCTCGGGGCTCTGCAAGCGTGAGTCAGGCGGCCACGCCTTGCGCCAGCGATGTGAAGCAACTGGTT
TCTAACGATGGATGTTTGGCTGACGGTCGATCAGCACAAACTTGGTCACCAAACCGAGGCGATCACGTAGTCAACGCGTGCATTCATGCAGGACTATTCC
AGTGATGCGTCTGCAAAGGCAAGGACGAAGGCGTGACTCCGTTGTCGTCGGCAGCTTGATGCTGCACGTGTGCCGGCACCGGACCGCAACCTGAAAACGA
CGCATCCCTCCGCGCCACAAACTGCACATTTTCACCACCGACCAGGGAGGATGGGCACTTCAAGTTGCGCAAACTACCGAAACTTGTGTGCACCACTCCA
CTCCAGTAATCAGGTCAAAGCTCGTCGACGTCATTCGCTCAACTTCCTCGCTACGACCGAAGCCTCCCTCCGCCATGTTGACCCGATTCCCCCAGCGCTT
GCGTCTACGTCTGCAATCGACAGACGCCTCGCGCGCACTGAGTTCGGCCGCTTCCTCGTCCTCTTCGTTGAAAGTTCTGATCATCGACGGATATTCGCCC
GATGGCCGCGCAGACCTGGAGGCTGGTGGCGCCAGCACGGCCGGCAAGCTGTACGTCAATCTGTTGAACAAGTCGGCGCCTGCTGGAATGAAAGTCGCGT
CGGATATCGTGTACCCAGCAGACAGCGATTTCAAAACGCCCGAACTATCCAAGGTGAGCTGACCGCTTGAATCTTCATCATTTCGTTGAGATTGTGGCAA
GAAAAACTGGCCAAATTGTGGAATGCTCAGAGGGTTATTGAGCGAAGAATTGATTAAACGTTGCGTGTTCGTTGACAGTACCATGCAGTGGCGTGGACAG
GATGCTCGCTGACAATTCATGATACCAAGGACGTCCGTGTTACCAAGCAGATCGACTTCGCCCAGAAGATCTTCGAGAAAGGTGAGGGTTCAATGGACGC
AGTGGAGGGGTCTTTATCATGATTAAAACAAGGCACTAATGTAGAGTTACATGCTGTTACTAGGCATCCCGCAGTACGGTAGCTGCTGGGCGGCGCAGAT
CGCGGTGGCTGCTGCCGGAGGTTACTGCGGGCCGAACCCGCGTGGTCGTGAGATGGGCCTTGCTCGTAAGATTGCACTGTCCCCCGAGGGTCGTGCACAC
CCGATGTTCGAGGGCAAACCGTCGGTTTTTGATGCATTCACTAGTCACAACGACGAGGTGACCCACATGCCTCCCGGCGGACTTGCGCTGGGTGGCAACG
ACTTCACGGCGGTACAGGCCGTGGCTGTGCGTCACAAGCAAGGAGAATTCTGGGGCATTCAGTACCATGCTGAATATGATTTGCACGAGCTCGCAAGGCT
CACGTACTGCCGCAGAGAGAAGCTTGTGGGTCTGGGTTTCTTTTCCGACATGAAGAGCGCTGACCAATATGTGGACGACCTTGAGAATCTGCACATCGAT
CCGTCTCGTTTCGACATTGCGTGGCGCCTTGGAATAGATGCCGACGTCATGGACGAAAACATCCGCCACTGTGAGACGCGCAACTTCATCAAGTACCTTG
CGCTTCCCTACAAGGCGGTTGTCGAGGGTAAATAGGCACCGTTAAACCGCATTATTGCATTGTATCGCGATACAAGGAGGTAATAGATGGTCAAGTGCTC
ACAACTTTAATCGTCGATGGAGATTATTGATAACCAGTCGCTTTCAAAAGTTCTCAAATCGCTTTGTATTAGCTCGCATTGGCAACAAGAGAGGATATAA
CCCCTCATTCCGGCTGCTTATGTAGAAATTTGCTGGGTGCATGCGTTGCCTTGGTTCTGGCAATAGCTTTCAGAGCTTTGTAGTGAGATACTAAAGGCGC
AATCTTCACATCAGGATGCTACAAGCTTAGTGTCGTCGATATTGTGGCGATTACTTTGAAGTACTTTTAAGTGCACTACACTATAGTACTGCATGTACAT
GTAGTAGGAAGTAAAGACCCGGTGCCACAATAAAACTGCTACTGGTACGAATCTTGAACGTCCAGCGCATTTGAGCTTTAATTCGTAAGTCCGCCTGCCA
CCGCTCAGCGCTCCAAGTCGTATGCGCCGAGTGTCAGCTCTCAAGATTCATTGCGTGAGTTGCAGTGAAGTCTCAAAAGCTTTTGCTGTTTTCTTTCGCT
CTTTGCAACAACTTCGCAAGCACCGGTACTCCATGCAGTAGTTTTCAGTTTCGTAAATGACAAGCTAAGAAATCATTGTTCAGTGGTTAACACGTTGAAC
GAAAATGCACGTGGATAAATGCAAAATGCAGAAAAGCTAACTTGCTACCCACAGAAACCACAGAGAGACGAGACGAACGTCAAGCGCAATCAAAACGTGT
TGTAAAGACGTCGAGATCTCGCCTGGCCCCGTTATCTACAGCGTACGCTTACTGCTTGCCGCTTTTCTTCTTGGCAGCCTTCTGCATCTTGACGGCCTGC
ACATTCACCTTGACATCGCGGGTGAAGGGCAGGTAGGTGACGCCGCCCATGAAGGGGACCAGCACCTCCGGGACCTTGACACCGTTCTCGTCCTGGCAGT
TCTCTAGAATGCAGCACACTGTACGCGTGGAAGCGCACAACGTCGAGTTCAGCATGTGCACATACTTCTTCTCGCGCTGGTTCTCCTTCTTGACGCCGCA
ACGAATCTCCATGGCACGCGCCTGGAAGTCCGTGCAGTTCGAGGCCGACACCAGCTCACGGTACTCCTTGTAGGCAGGGAACCACGCCTCCAGGTCGTAC
TTCTTGACAGCAGCGTTGTTAAGCTCGCCCGACACGATGTTCACCACGCGGTACGGCAGGTTCAGCGACTGGTAGAACTCCTCGGCATGACGCAGCATCT
CGTCGTGCATGGCAGCAGAGCTCTCCGGGTCCGTGATGCAGAACTGCTCCATCTTGTCGAACTGATGCACACGGAAGATACCCCACGTATCCTTGCCGTG
CGATCCAGCCTCTTTACGGAAGCAGGTGGAGAAGCCACCGTAGCGCAGAGGCAGCGAGCTCTCGGTGATCCACTCGCCCTTGTGATAGCCGCAGATGGGC
TGCTCGGACGTGGCAATCAGGTACTTCTCGTCCTCCCCGATGACCTTGTACAGCTGCTCGTCAAAGTCGTCGAGCTGCGCGACAGCGGCCATGCACTCCT
TGTTCATGAAGAAAGGCGGCTTGAGCATCTTGTACTGGGCCTTCATAAGGAAGGCCGTGGCGTAGGCCATGAGCGCCTGCTCCAGCAGGAAGCCGTAGCC
CGTGAGGAAATAGGCGCGGTGTCCAGCCACCTGCACGCCGCGTTCGGGCTCGTAGCCATCGATGCGATGCAGCACCTCGTGGTGGAAGTGCAGGCCGTCC
TTCTGGATGGGGGATCCCCACTTCTTGACCACCACGTTCTCATCCTCGTTGCTCGAGACGGGCACAGTGGGGTCCACCACGTTGCCGATCTTGGGCAGCT
CGCGGTCCAGGAGCAACTTGAGCTCGTCAGCCTCCTTCCTCTTCTCGGGCAGCTGGGCAGCCAGATCCTTGCGCTCGTCGCTGAGGGGCTTGAAGTCCTG
CTTGGCCTTGCTGAGCTTCTTGATCTCCTGCTGCAGCGCGTTCATCTGCATGCTGATGGTCTCCACCTCGCCCTGCTTCTTGCGCCACTGCTCGTCCAGC
TCGATCACCTTGTTCACGATGTCCACATCTAGGAAGCGCTTCTGCTGGTCGGCGCGCACGGCGTCCGGGTCGCCGCCACGCTCGGGACGCAGGCGGTTGA
TGTCGATAGGCATGTTGGAGTGCTTGGCTGAGGGTGCGTTGCTTTTCCACGTATGAGAGCGGGGGCCATCGAAGCGAAGATTCGCTCCAGCCACAGGAAT
AATCCTGGTCGGGCCTGAAAATGTGTAGTCGGTGGCGCATTAAGTAGCAACTAATCAGAGGCGGATATTCTTATATAACGTTTAAAACTATGAAGTATTA
TGTTTTTACTTTAAAAAAATATAATAAACGGTGAGAAAGTCGAAAGCGTGCGTTGTGAGGGACAAACTAATTTCCAGCACCTGGCACTGTCGTCGTCGCC
ACCCGACGAACCTGCGCCATCCTCGGAGACATTACCGGTTAGACCCTGCTTACCTAGTCTTCGCGGCAGTAGTTTTGCTTTGATGCGTCTATATTGAATA
TGTGCGGGTTGCTTGCTTTCCCTGCTGAGAGCCCTCGGTTAAAAATATTGTTTTGTCGTAGCAAGAAGCAACCTGGATTCATAAAACCACTTCAAAGTTT
CATCATTGCTTGCATATCGGCTGTTGCTACGGAGATCGTCATAGCAGCGTGCCTCGTTGGTGGTGGCGCTCCTGCGTGGCGGCGAAACGATCCACAACTG
TGTTGGCGTTCGTGGCGCCTTTCGTTAGTGTGGCCAGGTACGAAACCAACAGAGCGTCGTTGTACTCTTGCGTGAACGCCGCGTCGAAATGCTCCGACTT
CATGGCGGGCAGCTGATTGCAAATGCTCGAGATGTGGCGCAGCAAGTTGTGGTCTAGCGGGGCCTCGCCATCTTTCATGGCCTGCAAGAAGCGCAGCAGC
ACGTCAACCTGACGGTCCAGCATCTTTACAGCGTCTCGGACGTTGCCCAGGTACGGGTGCACTGAAGCAGCGGCAGCGAACGTTAGGTTAGAATGAATGC
CACATCCAAACAAATATCCTGAAGACGATGCACTTACACGACGACTTGCTCGCATCGCCAATCGGTGCGATCTTGGAAATGTGGTCGATGGCGATACCTT
CGGCTTCGGAGGTATCGATTTTGAAAGGCGCCTTGACAAAGATCATCTTGGGCACGCCGTTCAGCATGTGCAGCTCCGACTCGAATAGCGAGATCGGCAG
CTTCTTCTTGGTGCTCGGCCCCTTGGCCTCGGGGTCTAAGATCATGAACAGCGGGCTCTCATTGAATTCCATCACCTGTACGATAACCAAATACCTGTCA
GGCCAACCTTCACCATCTCTACCAACCCACACGCCCTTCTCACCACGCGATGCACCGCCAGATCACTGGGCAGAGCCTTAGCGCCCACCGTGTACCACCC
TAGCAGCTCAAAGCCCGGGAAAACCTGAGAAACTGCAGCACCGCAAAACCCCGCGTCAGTTGCGCAGTCTCCTTCCTCTTAGCGTCTCCACGTCGTACAT
TGCTGAATGCGCGAAGTGAGGAACTCCTTGTCGATCTGAATCTCTCCACTGGCGCCCACATCAAACTTCATCTCGAACGAGTCGTATACGTCCACGTCCA
GCCCCTTCTGGATACCGAAGAGCGCGCCGATGACCTGCGGCGCCTCCGTCTGGCTCAGCTGCGAGTTGCACTTCTGCCGGGTCTGGTGGTCGGCGATGTT
CACGATCACCAGCGGGTGGATCTGGATTTGCCGCTCGCCTCCGCCAGCGCCGCTGTCCTCGCGCTGCACCAGCATCTCCTCGTCCTTCTCCTCTGCGCTC
GCCATCTCCGTGTCCTCGCGCTGCATCTCCTTCTCGTGTTGATGTGTGTCGACGATCCTTGGTGTAACGTGGTGTGTTCACAAATTCGGTGACTTGACTG
TTGTTGTGGTGTACGCTATATGGTGGCAACAGTTGGACCGTGCCTCTAAATGATGTACGATTTGTGTTCATACGTTTTTGCACTCAATTGCCGACATGAC
GGCACTGAATAGTCAGTGACTATTCCGGTAACGCTCAAGCTCGTTGAACAGGCCCTCAAGAAACGCAGTGCCGCGCTGAACCAAATCCCCCCTCCGTTGC
AGCATCGGAACAACGCAAACCGCCGCCGGGGGCCGCCGCCAACATGAGCGACCAAGTGTCCGACGACTTCATCTGGTCCTTGGACGTACGCGACGACCCG
AGAGGCAGGAAATTGATACATGACTGACATCTTCTGCGTCCGTTATATGTTGCTCAGAGCCTGATAAAGAAGGATGCGGGCGCCGACGTGGAGGGCGACG
CGGACCTCGTGCGCGCAAGCTTGTACACGCAGGACAACCTGCTGGGCTCCATGATCGGCAGTGACCTGGTATTCGGGCGTCGAGAATCCGCCAAGTTTGC
GCAGGATGAGGACGTCGCAATGGGAGGCTTCGGACGGCCCACGGGCCTCATGGGCTACGGTATCAACGAGGACGAACTGGATGATGACGAGACAATCGGC
CCGATTGAGGAGCGCCTCCCAGCCAACTTGAGCGCCACGCAGCCAAGCAGCGGCAGCAGTTATTACGCCCGACAGTCCTCCAGTCAGCTCAGTGAAGACA
CAGATAGGTCCTTTTCGTTCGCATCGGAGGATGACCACGGCATGGACCCTCTGTCCCTACCTTCACCGCAGAGGAAACGTTCCACGAGACGATTGAGCGA
CGGAGATCAGGATACCTATGAACAGCGAATCGAGGCGTCCCTGGCTGGGTACATTACCAAGTCGCTGAACATCGAGTCGCGCATGGCCGCAGAGGAGCAA
CTGGATCGACCATTTACAATGAGCGACCTTGCTCATTTCAGTCCGCAGTTCGGGCGAGAGCTGTATCTCGAACGACTAGGGCAGAGTCTGCAGGAGCAAG
AAAGTGGAGGAAAATCGCTGGCTTCGTACCGACGAGCCTCCATGCAGCGGATGTCCACACCAGCAGATATTATTCGGCAAGGATGGATCATGAAACGCGG
AGAAGTGGTCCCTAGTTACCGGAAGCGCTGGTTCACGCTGCGTCGGATGCCGCAGGGACCGATGCTAACGTACGCCAAAGACAACAATGAGACCTCTCCA
GCTAAAATGATTGATCTTAGCTCAACGTCGCGCTGCGTGACTGTCACCGGCAGGAACGCAAAGGAGCACGAATTCAAGGTAATGACATCTGCGGATTCCT
CGAGGCGTGAATACTGCATGGTGGCAGCTTCCAGCTACGAGATGACGCAGTGGGTGTGCGCTATTCAAGCTGCCATCAGTGCCGGAAACAGTTCTACGTT
TGACGGCGCCACAGACTTCAAACAGCTATGGCACGAAGCTGGAATCCAAGGATTTTTGGTTCGATACGGTGTGCGCAAGTGTAGCTCGCGGAATCGTCTT
CAAACACGAGTCCTCGAGCTTAATTTTGCAGAACAAACCCTTACAAACTCGCGACGAGGAGAGACCCTCACGACATTTCATTTCACTGATATTCGCGGCA
TTTCAGTAAGTAGTGTGCGCTCTAGCGGCGAGGAGCATGGTGTCAGTATCGATTTCCACGGACGGCATCGATCCTGGCCAATTTTCTTGGATTCGGTGGA
GGCTCGAGATGATTTGTTTGGTATTCTGCAGCGTATTGTTGGCAATGTGGTGTCGGGCGAGGACCTTGAAAAGCGGTCGTCTCGGTTGACGCTCAAGACT
GGTCACCTCGAAACAAAAAATGCTGGGCCCCACGCTACGCTGCGCGGTCGTTTATTTGTCTGCCTTCACGAAAACTGTATCGTGTTTTATCCGGAAGATG
GAGATACCAGTACACGGCCGTGGTATGTCATTGCCCTTAAGGGCCTTCGCGTTTCGGTTCGAGAAGAAAAGCGAATACTTTATATTGGACGGCTATCGTT
AGCGTGCTCGTCCACAGCAGACTGTCGTGCCTGGTATGATGCCATCTTAGCGGCTACGTGCCTACCAGCAGAAATTATTGAAATCGAGCTAAAGGAGCGA
GCGAAGATCCGCACCGTTTTCCAGGTGTGTGTGTCTCGGCTGCGGAAATTGCTCAAGGCTAAAGTGACGCCCGAATCGAATGGACCACCGAAAGATCAGA
AGACGGTGACTTTGTTGATCAGCAAGCTCTGGGAGCTCGTTTTCCCGGGAGAACCTTTCACGTCAAATGCCGATCCCAAGTGGTTGGAGATTGGTTTTCA
AAGAGGTGGCCCTGCGTCTGATCTTCGTTCAAGCGGTCTTCTTGGACTCTACTGCCTAATCTTCTTTGCCAGCTATCCGTCGAGCGAATTTCAACGTATC
CTGAAGCGCACACGGCATGGTGTGAGTGAAGGTAACATGAAGAATTACCCTCTGGCGATTGCGTGCATCAATGTGGCATCGCTTTTGACCGAAACGCTTG
GTTTGGGCGACGCTGGAACGCACTCGGACGGTTGTTCGTTAAACGCGATGAAGACATACAGCCTTTTGGTTGCACAGAGTGTCAGTAAGTCGAGGTCTTC
AAAACCAGCAAGGGTGTTTTCGACGTCGCGGCCGCTAAGTGCTTACGAATCCTGGGAGGAAATTGTCGACGAACCGGAGAACCACGTGTTTGAGACCATC
TTCAGCCTTCTCTTCCCGGTTCTAGACTCGCTTTTCGTTGAAATGGGAGCGGTAAGTTTGTACCTCGGTGCGTGAAAGGTGATGTACAAGCTGACGGTGC
TGTTTGTTTGCTACAGGGGTACATGGAATTCGGTCAAGTCACCATCGCGTTCCGACAGCGCGTGAATGAGATTTTCAACGCGCAGCCCAAGTCACTGAAG
GAGCTTCAGAAGCTGGCGAGCGAGCCTTGCACGGGCACACTAGCGGTGCCGACGGTGTTGCAAAGTAAGCATCACAAGATAGGGAAGATTGGCTTGGGCA
AGAAAATAGTGAGGGCGGGCGGCGTATAGCTACGACGAATGCAGTCTAGTCTTGCCACCCCACATAGAGATTTTGAAACAAAGCCAATAGAAATGCCATC
CACTTTGCGCGTTGAAGATGCATTGAAATGAGTTCCCGACAACTTACAGTATAGCATAAACTTCACGTGACCACAGTCGTGGGTCAGGACGCTCCACCCC
ACACTCCGATAGATGCGGCGCTGCCACCAACGCTATTTGCTCGCGGTAGCTGAACTGGTGGAGGAGTACGATGCAGATGCAAATGCCGACCCCTTCCGCC
ACCACGAGCACCACCTCCTGATCCACTGCCCCGTCCATAGTGGTGGTGGCGAGGTGGCTGATGGTGCCCAGATCCTCCATGATTCACGGCCGAGCGGGCC
AAGAAGCGTTCCCACGACAGCTTCATCTCACGCAGAAGCTGTACTGATTGCTCTTTTGCACGGCCCAAAGCCTACACAAGAATTTCAACATGTCTGATTA
GAAATTCTCGAGACCTCTCAAAAACGAGAATCCTTACCGATTCCGATGTGCTGGTAATCTGAATGTAAGCTTCTGGCATCGTATGCGAAGAAATCTCCTT
TTTGCCGTCACCCCGACCTTTGCTCCACTTGGCTAGCGACTGTGGCCACGGTCCAAAGTAACGCAACTGGGCACATGCAATAGCTTCGATCTTTTTCAGG
TGGATGCCGCGCTCGCCGAGCAACTTTCCCGGGAAGTTAAACCGCCGTGACACGAGCGCCTCCGCGTCGACAATGTCATACACATTCACGCGTGCAAAGA
GGTGGCCAGAGGAAACAGACTCCTCGCCATCACCACTCAGCACAGCGTGCTTAAAGCTGCTGCTTCCGCTGCTTTCGCTATCATCTTGACCCATTTCATC
TTGTTCCAGGGCTGAGAGTCCAAGCTTCTTCATTTGCCGTCCTCTTTCTTCTAGCACTTTGCCTTCCTCTTCCTTTCCTTGAAGCCGTAGGCATTTTCCG
ATTTGTTCTAGTTTCCACGAAGTAAAAGCGTCAATTAATATGACGACAAGTGCATGCTGGCTCACGAATTCGTACCAATACAAAAACCAACGTCACGTGT
ATCTGGGAAAAGTTGCTGACGAATGTCTTGTGCTTTTTTGTAGGCAGCAATAGCTTCACCATAGCGTTTCTATCAACAATCGCATGTCAATAATCAAACA
AAACTGTCGGCTTAATCCACTGCCATACCTGATCCCGATACACACGCGCGAGATTAATAGAGATTCGTGCTGCACGGGGGCTGATGTCATTGAAGTATCG
ATCCGTGATCTGCAGGGCTTCCTTAATGTTTTCTTCTGCTCCACGCCAATCTTTCTGTTTCCGAGAGAAAAGTTGTAAGAAAGCGGCCACATGCAGAATA
ATCGAGTTGGTAAACGAGACATACCGCTAGCCGCTTGAAATTGCCCATGTTGTTCAGTGTAGCAGCGGTCTCAAAGCTCGCATTTCCGAGTCTGCTCCGG
CGAATTCGGAGTGCTCGGTTGTACAGACGACCAATTTCTGCTCGCTGTGCTGCTAGCTCCACCTCGCTGACAACAGCAAACAAGCGTTAGATTGACATGA
CTGGGGTTTTCGGGGCAATTGATTTGACATACCTCAAGTGCTGGGTTTCAAGTTGGTTCGAAAGATAGAGCGCCAGGTTGTTCAGCGACTGAGCAACTTG
AGGATGATTCTCACCAAGCGTTATCTCTCGTATCTTGAGGGATTGACGATACATGCCAGCGATGTCGGGCCGTGCCTCTTCCTCCCCAGTTGTAGTACTC
TTGTTCACACCCGTGGTGACACTCTCCTGGCTAGGGCTTGTCACACTTTCGCTGCTTGTACTAGATCTACTTGGGCTCGGACTAGAGCCAGAACGAGCAC
CTCGGTGAGCAGTGTCATTTCGCCGCCCACCGCTTTTTCCTCCCCTCATGAGCTTTTCTCTCGATTCACGAGCATCCTCACGCAGTGCCGCCGACGGTGA
TCGACGTTTACCGGCGGTTGGATAGTTCTTGTAAAAGTTCGCTAAGTTGTTCAGGCTCGTAGCGTACTCTGGATGATTTTTACTTAGCACCCGACTACGC
ATCTCAAGCGCCCCTTTCAGCAAGCGCTCAGCGTGCTGCAGCAACCAAACATTATGTGCAAGATACCCCCAGCGCGTGCTGAGACAATTGCCAAACTGAT
TAAGCACTTCAGCCACCTGCGGATGTTCCGACCAGCCCAGTACCTCTCGTTGCAGCCGCAGCGATTCAAGATAATGGTACTCTCCTGCAACCCAGTCGGT
GACATCGCAACAGGCGTAGCCCAAGTCAGTAAGTAGAAGAGCTTCTAGTGCAATGAGCTCACGTATTCCAACACAAGTACAGCGATCATGTGCTGCAGCA
GCAGCGACGGGAGGCTGTGGTTCCTCGAATGAAGGCAATTTGTCCAGCAGCGACAGCTCTCGATCATACTTAGCTTCTTCCACATCCCACAACAATGCTG
CAGGATCATTTTCACGGTTCCCACATGTACAATGTAGCGAACGTGTCTCCCGTGAGAGCTGCAAACAGGAAGATACCACTTGAATACGCCGTCGTGGTTC
CACACGCGCGCGAAAAATGAAGCGACACCGAACAACTAGATTACTGTACAGAAGCCCGTCCACAATCGAGGAATTTGTGAGCGCTGCAGCACCTGCAGAC
CGGCGGCTACTCCCGGTACTGCTGCTTGTACTTGCACCAAAGCTACTGCTGTGGCGCTCAATGGATGGGTTGGGCGTTAATGCATCATCTGTGTACAATG
CTGGCTCACTTTTTGATCTCATAGTACTGGTGGAGTTTACAGGAACTTCACCAAGCTGATCACTAACAAGCTCTTGTTGTGTACGACGATTGCTCTCACG
CACCTGCTCAATGCTCTGTGACGTGAGCTCATGAGCTAACCGCATCGCCGATTCAATATTAGCACGTTCCTTATCGAACAGCGCCAACGTGCCCTCAAAG
CGGTAGGCATGTGAAGCCTTAGCCACGATCATGCAGTAATAGCGCACAAAACGTCGCTTCCAAGTGAGAAGAAGCTCTTTACCCAGCGGAAAGCTCCTAG
TTGGTGCGCCCATCGATGCCTCAACAAATGATGCAGGTGCAAAACTTGGGCTTGAAGAGAGGGGCCCTGCGTCGGGGAAACACTCCTCGCCCATGCGGCC
AGCTTCTTCTTCAGCAAAAAGCTGCACTAGATTGTGCATACGGTAACGATTCGTTTTCGTGTCGAACTCCACTAGCGACCATTGATGAAGAATCTCAAGT
GCTACACTTGCCGAGGGTACACTCACTTCACGAGCTTTCACCTCTTCGCAGCTCTCTAGATCCAGCAAATCGTAGCTGTCATTCGTCATTGCACCATCAT
TGTCGAAGCCGAATCCATCCATGTTTGAGAGCTGGGATCCAAGACTACGCACGGAGGAAACGTCATCGTCACGACTACGACTTCGGTGGCTCTTGGCGTA
CGCATGAGCAGGGAAGATCGATGAGGTTGAAGCACTTGAAGTACTAGTGTTAATACCCGCTGAACCACTTAATGACGAAGACATCAAAGAGTAGCCGCTA
CTCCCTGCCAACTTGCCAGCAGCATTCTGCTCCGTCAAAACACTGGAAAGCACAGCATCTGCCGCTTCGATCTCGAAGCTACCCCGAAAAAATCCAAACG
CCATGAACGCTAAGCGCAGTGGCTCGTCCAGGTGACAGAAAGATGAGCGAATGCAGCGATCCACACATTCTTTGTGTCCAACCTGGTTGAGTTCTCTGAT
TGTTTCGAACCTGTGCTCATCACGCTGGCACACAGAACGAGAAGGGTGTACGTAAGATAAAATGACAAGTAAGTCTACAGCGAACCCATTCAGGCTTACT
TACCTCTAAGTACTCGATCATACGCTCAGGTGTGACTGTCATCCGTGCGTTAGCAAGTGCACGACCAACAACGCGAATCGCTAGTGGAAGGCAGCCGCAA
ATCCTTGCCAGGCGTTCAGCTAGTTTTGTAGAACAACCAGGGGCGACAAGGCAGAGCAGCTCCGTCTGTACATGTACAGCAGCGCAAGCAGA