Description :
From Genome Similarity Track
Location :
Scaffold_1760:4541- 6223
Transcript NameFunction/comments
Phypl_g14097hypothetical protein

Sequence
1682 bases(100 bases per row)
CTGGGACATCACGACTCACCTGAGATGGTGGTGCCGAAGCAAGAgaagcgtcagcagcggTCTGTCGAGAAACcgaagctccaggagcaAGCTCGACTGA
GTCATCACCAGAAACAGTGTGAGCTATAGCCGAAGCTTCATCGTTGTCATCGTCCGACAACACGGGAGGCGCACCCacgcgaccagcacgagatCGCCGA
GGTGTCGGCGAAATAACGTCATCATCGAGGTCGAGTACGTCATCGTCATTCGCATTCTCCAGTTCAATCATCAAGGAAAAATGGAATGACGACTAAACGG
CTTTGCGGCGGAGAACACGACCCGAAGACGAGGTAGCCGGCACCGCAGGAAATTTGCCAGACAAATCCAAGGTAGACGAGATGCGTGACGAAGACTCCGG
AGCAGCGGGCTTGGAAACGCCCTCCACGTCAGATGAGAGATCAATGGTGGACACTGAGCAGTCTGACtgcgaagttgaagtcaacCGATGACTGCGGCGA
GGACTCGGTGACTGGACAGTCTGAGGCGACACCAAAGGACGATTCTGCTTCTTCTTAGCTGGCGTGGAACTccgagtacgtggcgaagAATTGACGCTGG
AACTAATAGCGGCCTGTCAAGACGCATCGGTCGTGACAAAAACCGGGTCCAACACGTCACCGGTGCTTCGTTTTGAGTCATGGTGACGTCGCTTCCGAGA
AACGACTCGCGTGTCGAGAGAGGTCTTgcgcgcagctcgactcTTTGAGATAGCTTCTGCCGAAGTACCAGGCGAAGTCTTGCGCGACGCCATCTCACGA
GCTTCAGCCGACAATTCCAAATCATCACCCTCCATGTACGCCGCTCGAGCCAAGTCGCCGGCAAGCGTAACAGAAGGTGTCGACGGGTCGGCATCCTTGA
AGACCTTGCGCAGAACCGCCCGTGTCTCGTCGCTGACGCCCAGCAAATCCCAATTCAGCTCGCCGGTGGATAAGCCTGCGCATGAGTTATCATAGCCCGG
TTAACCGACACTCCGGAAGCACGTGCAATGCAACAACAAGATAACGAACCTTCGGTGACGAGAACCAAGACATCGGGGTCCatctcttccagcttcaCAT
GAGTGCGGAGAGTCCTGTTGGCTTGGACGAGCCgcttcacctgctcctgCAAGTCTTCGTTACGCTGACGAAGTCGAGCGGAAGGTGAGCCATCGACAAT
ATCCGAATTGGACAACAGCCTATGTAGCCGCTTGCTCTGGGAGGTCGACGTCACCACGACTGCCTTGAATACttcctgctcacgctgcaaCTGACGTTTG
AGGCGGTTGACAGCTTCTTCGGTAGCCTTGACGCGGTtctcttggcgctgcgaGAGTTCGTTGTGGAGCTCCTCCTGCGCGTGATACTCGTCGATTTCCC
ACAGGGAGAGTTGCTCCAGttcgcgctgccgacggaTCTCTTTCTTGGCTTGATCGAGTTCCTTGGTGGCTTCACGCGAAAACAACTTGGCGTTCTCCCG
AAGCATGACCTCTCTAACTCGGGACTGTTCGGCAGCAGTCTGAGCAACCTCGGCAGAGTACAGTTGAGAACGCAGCATGGACACTTCCGACGAAGTATCA
CGCGGATCTTCTGGTTGGGGAaccacggacgccaccacTTCCTCCAGAGTGCGTGCAGTCTTGAAGCGGTGCTGCATCCGCC