Description :
From Genome Similarity Track
Location :
Scaffold_233:4541- 5697
Sequence
1156 bases(100 bases per row)
AAAATCGCAGTCAGAGTCCGGTAGCTAGGACGCTCGACCAGCGGTCCAGACTCTTCAACTTCCGCTTCGTTGCATCTCCAGGTCCACAGCTGCTTTTAAC
GCAAGTGTTTGCCACTCCCGATACCGGTTTGAATCCTTTCCTAGCGAATCCAGTTCGACGCTGGATCTGCCCAACGGGTAACCAGATTGCCAAACACACC
AAATGATCCAGTACCAGGCGGCTCGTGCTGATGTTTGGTGATCCGGAGGTATGACTTATTACTGAATCCACCATTCACCACCGTGATCACCCATTTTTTC
CCTCTCATTACCCACAGTTCAAACCGCTTGTTGTGGGACTTGAGTGAGATCTCTGTCCATTGGCCAGGACCGACTTCATGGAATCCCGTTGCGTAGACCG
CGTCAGCCTTGCTGCTATACAGTGGCTTACGGTCGGTCATTTGGATGCGAACTTCGTCCGGCAGACAGAGCGTTCCGTCAGCCAGGTCCAACCTCACCCC
CGCAGGAACCATAAAATCCATGCCGAGAATGACGTCTTGTCCTGAGAGATCTCCAACCCACAAACGGAACTTGTACACCAACTCTCCAGCCAGAGTGAGC
TTGACTTCTGCTCGGCCTTCTGTGCGGTACACAGCATCCCCCAGACCAACACAATCCATTGTCTGTGTTGTATCAATTTCACAACCCACCTTACGTGCAA
AGGTAGAGTCGATTATCGACACTTCGGCTCCAGTATCACAGAGTGGGACGGCACGGACATTGTTGACCGCACCGGTCGCCTTCGACTGCTTGAACCACTT
GGAGGGAGTGTAATACTTCCAGTAACCTCGGCGTTCACCCGGCGACAGTTGAAGGGCCACCACACAAGGGCGACGCGAATAGTCACCTTCATCCGAGGTA
AGAGGTCTGGCTGTATTCACCGCATTACAGGAAGTTGGGTCTTCTAACGCTCGCGCCTTCCTCTGAACATATGCATAAATGCAGAACTTCGATCGCTCGT
CACGTACCAGGCTGTTCAGGTCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTCGGACAGCAGTCCGGCATGGCGAGTCGGGTTGTACCATTGG
CGAACAGCATCGAAGAAGTCGCCGATTTTACACTGACCTGCTTCGTGAACGTCTCC