Description :
From Genome Similarity Track
Location :
Scaffold_1376:454- 4639
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1376-snap-gene-0.1Crinkler (CRN) family protein
Pytar_ATCC12531maker-par_contig_1376-fgenesh-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
4185 bases(100 bases per row)
AATCAATTCACCTGCTGCTTCTCCATGTCCAGTCTTGACAATCCTGCTCTGCCGCTTCCATACCCTGTCGAGGCCACTCCGTCGAATCAATCATCGCTCT
CGCCAGTGGTGTCGCCATCCTCGCTCCGCTTTCGTTTTGCGGTTTTTGGAGACAAGCGGGTCCGGTGCGAGCGTGTCGTCGACTGCTGGTTCGGCATCAC
TGCTCCGTGATGTGTGGCGTGCCGGCAGTGGTGGCTGTCTGCTTCGACGTTGTTGCGAGCACCATCCATTTTCGGGTCGATCCCGGCTTCTCCATAGTAC
CCGACGTGGACGTCGCATACGTCTGACGCCTCCTCCACATCCGCTCGAGTGGTGAAGGCAAGCTCCTTGGCAGCAGCTACCGTCTGGCAAACCACGATGA
AAATGGGTTTCTCTTGCCCAAGGATCGCATTGAGAGTCTTCAAGGATGCGACATTGACAGTGCGCTTGTCGGAGACTGTCATCTGCAAATAGGCAACTCT
ACCATCCTCGAGCTTGACAATGCTGTCGACGGTTTCGAGGTTTTGCGTGGACGGACACCAATACGAATACTTGTCGTCGTTCTTCCAATCCACCAGACTT
TTTTCCAACACGTCATCGGTCGAATCTGTTTCGATGCTGCCGCCTTCCTTCATACTCAGTTGTGTAAACTGGAGGGTCTCGGGAGCATCCGGTTGTCTGA
ACTCCAGCTTGTGGTACGGGGTCGTGCTCAATTGCAGTGTGTTGTCAGCAGCCAGGTGGTGGAAGACCAGCTCAAATAAGAGTCCCGCGAGCGCAGCGGA
CTTCGACCCATTAGCTCTAGCCCAATGGTAGACCGAGGCGATGTCATTGTCTCCAACTCTTTTCTTCTTTTGAAGTTCGGTGATCGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGAACGTTCGGCGCAGACAATCGACCTGGTCCGTACCC
GAGTTTACGACCCCCGAGCAGAAGAGGAGAGGGAGTGGATCTTCGACGCGATTCACGACCGTGAGCATCAGAATTTCGATTTTGTCGGCGTTCTCGAGTG
TGAAATCGCGAACACTCCCACCCGAGTAGTAAAACCGCTTGCATACGTCGTCACTCCACTCATAGATGGATTCGCCGAGCGAAAAGAGATCGTCTGGGCG
CCAGCTCGGGAACAGATAAGTGTCCGTTATCGCGGCCTCGTCAGACTTGAGATGGACTTGCTGGGAGGTCGTGAGGAGATGGTAGACCTTCAAGCCGGCG
GGAATGTCCTTGTGCACAAAGCCATCCAGCATGAGGCAAACAGACGGGAAGTCGCGGTGGTTCTCCTTCACCGTGCGGAGGATGGCGACGGCGTCTTCTA
GTGCACAGTCCCTCTTCGAAAAATAGACGACTTGATCGCCGTCGTGGCCCACAAAAAAGGCGTAGAAGGCTCGAGCTACTTGCCGCACGACCAACACGTT
CTTCTTCTTGACAATGGCAACGTGCATCGCGATGAGGCAAAACATTGTGGACTTACCCACGCCTGAGGAGCCATTCAGGACGACGCGCTTGTCTGTGGAC
GTATCCCTGCCGGACACTGGGAACCATCGGTCGAGCAGCATCGCCGCGATTTGTTTCTCCTCCTGGCGCCAGTAGATCTTGCCGTGTTGCGTGCAACCAC
CGAGTGCCTTCATGAACGCGTGGAGATGCTGGATGCTGTGGACGGCGCCTGCTTGCCAAGTTGGTACCGCCTCGCACTCTTTCCGCAGCTCCTTCGCTGT
CTCCAGTGAGGACATCGCCAGCGGGACACATTCGCGCGCGTTGAAGCGCGCATTCGCCAACAGAGCGAACGGTGGAAAAGGTGGAAGTCGAACCGGAGGC
GTTCGGACGATTAGCGGATCGCTGGAAGCCTCGTCCAGCGACTCAATTGAGTCAGCGAATCCCAACGGCGCGCGCTTGGCGTCCATGTCAGCATGATTTG
CATAGACTTTAAGTTGGAGAGACGCAATGCCAACGAGAAGGCTGTCCGCGTAGTCTGCCTTCACCGCTTTTCGCAGCATCGCCACTATGGCAGTATCGAC
GGAGACACAGTCCACGCCCGCCACGGCCTCGCCGGCCGCGCCGACCAACTGGAACCACCTTCGTTGAGTTCTCGTACAAGCGAATGGCGGCGTTTGAACG
ATCAGCGGATCTGTGGGGGACTCACCCAGAGACGCAATCGAGTCAGCGGATCCCAACGGTGCGCGCTTGGCGTCAAAGACCGCGCGGTTGGCGTAGACGA
CGAGGTCTGTAGGCGCTGTTTTATGGAGACGAGTGTTCGCGTACTCCGCCTTCACCACTTTTCGCAGCACCGCCACGTAAGGGACATCGATGGAGGCAAC
ATGGACGTCCACGATGGCCACACCAGCCGCGTCGACCAACTGGAACCACTTGAGCCCCATGGTCGGAGAATCGGACTGAACCGGAACAGGAATGTGAGAG
AAATGGATTTTTGGGCCATCGACTTCATAACTGGATCGAAGATAACTTCGCAGAAATCTCCCGTACCCCGGTTGCCATCACTCAGCATCATCTCGAGGCA
GACCGGCACAGATTGAAGCGGACCATATTTGGTACGAAGCCTTACAGAGAGCGGTACGACTTCGACCCGACGTACCTGAGGCAGCCGGGCACCCCCTTCG
CATCTCCACGGGTTTATGAAGCTACTTGGCGGGTCCGCGCAAACCGGCCAGCTCTTCTGGCACCATGAAGAGAGACAAGTCGCAGCGATGCTTGTGGACG
GATGGTTTCGACCACCCACCAACGACAATCCCAATCCTCTCCCCAACAAGAAGAGTTTCCTGGAGAGCCCACCAGACACAGGCAAGTCGACGAATTTCTG
CGTCATGGCCATACACGTCGCTCTCGTCCAGAATAGGAACGTGTGGTCGTGCGGCATGCGGACGAGAGGTATCAAACCTCCTGTCTCTTCTTCGTGGGCC
ACAGAGGTGACCAAGTCGTCTACTTCTTGAAACAGGACTGTGAACTGGAAGAAGCCGTTGCCCTCCGCTGCATGTTCAAGTCCCACGGACGGCCTTGTCT
ATGACGACCTGCCCGACGCCTTGGATACCTTCAAGCTCCTCGCTCGCGGCAAGTTGATTTCAAGCCCCGTGCGTTCATGCAAGCGTACTGCTGCCTTTCT
CCAAGCTGGCGCGCAAATAATCTGTACGAGCTTGGGAGATCCATCTTCCAGTGGCAAGACGCAGCGGTTTTACTACTCGGGCGGGAGCGTCTCGAGTCAA
TCGAAGAGATTGCCAACGTGATTGAAATGGCCGTGATCTCGGTCAGGGATCCACGCCATTTCGTTTCCAGTTGGATGCCCGAGAGTGTGGAGAAGAGTGC
GTGTGTGTGTCTGCGTCGCGCGTTCGTGAAGCGCGACCAAGTGGGATCCGCGAGCCTACCGCCGCTGCTCGTGCTGGAATCACGTCGTGGATTCCGAGTA
CGCACTCACACTGCTCGAAGACCGAATAGGCCTCGTCGGCACGTGGACCAGAACTGGTGGGGCAAGCTAAACAGGCGGGTATGCGCCATACTCGCGAGAT
GATAATGTGAACGGGCGATGGAACAGCTAAAATATATCACCATCACTATACCTTCTTGCGTCTTGTTTCAATACACGAGCTGCGCGTTCTCGAGCAGCTC
GAAGAACTCGCCGTCGCCCGACGCGATGAGCTCGTCGGCAGTGCCGAAGCCTTCAACTTGGCCGTGCGCCATGACCAGGAGTTTATCGAACTTGAGCACG
GCGTCAATGCGATGGGAGATGCAGAGCAGCGTCATGTCGGGGTCGAGGCTTTGGCACACGACGCGCTGGACGCTGAGGTCGGTCTGCTGGTCGGTCGCCG
TCGTGGCCTCGTCCAGGAAAATGACACGTGCGCGTAGCAGCAGCGCGCGCGCAAGACAGAGCAGCTGCCGCTCGCCGTTGCTCCAGGCGTCCACCACGTC
TTCCAGCGACGCGTCGAGCTGGCAGGGCACGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCACGCGGCGGATGGACGGCTTGAGACCCGTCTTGTCG
AGCACGGACCAGAGCTCGAAATCATCCATCGGCGAAGACGATGACGGCGACAACGACGAGACGAACGTGAACTCGTCGGCCTCGG