Description :
From Genome Similarity Track
Location :
Scaffold_22:453915- 456555
Sequence
2640 bases(100 bases per row)
GGGGTGATTCAGCCCATCGACGTGAACATGCACCAAAACTCACTGCAATCTAGCAATCCGTTAGATCACGATGAATGCAGCACCGAGTTGGAGACTTCAA
TGTCTGGTGATTATGATGACAAGGAGTTGCATGTGGCATTGCTCAAGGCTGGCGTGGCGCTGGACATTGTGAAGAAGGTAATGGCGCTTCCTTCTGACGA
AGCAGAAATAGTGATATCTGAAGGCCCTCGCCACGAAGAGCAACACTTTGAGGTTGCGGTGGAGAGTGAGTCAAGCAACTCAGAGCATCAAACGATTGCA
ACTGTATCAGATCCTCTTCATTGTCCGGCTGTCACGGAATCTCTGGGTACCTGCGAGCAATATTCTGTGTTTGATCGTGCAGTTCGCGACGAAATAGCGC
GAATGATGGACGAAGACGAGACATTTAATCAAATTATACGTCGCAACAAAGATGCGAAGCCGCCATCAAAGTACAGTGCGCCTCAATTGTTCTCTGACAT
GGCGTTCAGAGTCGGCCTATTCCCGAAAATCCAAGCCGAGGATCGAGGCAACCTGATTGAGATTATCATGTACACGTTTGGGAGCTTCTTTACAGAGTAC
CTCTTGTGCGATTTTTCCGAGATTCGTGCACTTTGTATCATGATCGCAGAGAGGTTTCTTCCGGCTCTCAAAGAAACCACGGGTGTTGTGGTGATTTACG
AAGGCTCGCTTGCGCTGCTGAGGGTAAGTTTCCAGGACTCGGATTTAGGCGTTTTCCAGGCCTGTCTTCATCTGGCGCAAACGATTTTTCAGCAATCACT
AGTGAAAACGAGTCTTCCGCAGGCATTTTCGCCTTTTGATAGTACCATTGGAATCGTTAGCGAGTTACCGAAAAGCTACGTCAAATACGGACTGCGCCTT
GTCATGAAAGCCATTCTAGCAAATCCGTGTTGCTGGACAAAAGAACACCATCAATTCAACGCATCGACTTTCAGGAAGAAAAGGATCAACCTGGATTTTC
TGCGGTTTGTTCGCTTGCTGATATCCCAAGAAGCCGTTCGGTACAGCTTTTATCAAGTTCTGCTCCCAGTTGAGCATATTTCAAGTGGCAACCAAATCGT
CGAAGGTGGCTCAGAGCAGAGCATCCATCTCGTCGAAACACCAAATCGCCTACGTCTGTTCCGACTGCTTTTGCAACGGCAGAAAGCAAGCCACGTCACC
ATCCCTGCAGATATTCTGAAGCAGATTGACCACTTCTGTAAAGCACTCAGTTACCGCGACACACCGACAAGCACCGCTGCGTCGTCTTCTTCAGTGTGCC
GATTGGCAGCAGACTGCTTGCACTTACTTCATGCAAACACTGCGTCTCGACTCAAGCCGTTCAATTTCATGCAACTGAACAAAGTTCACACGCAAGTCGA
CGAACTGGAGATGGAAGGTAAGGGCAAAAGCTTCTGCCAATACCATTCTCACAGATGTTCTCAGTCTATTTCATGATGACAGGTCCAACAGCGCATGAGC
CGCGTTTCGTTCAATTTGCGATTGCATCTGAGCAGCAAGCGCTTCTCCAAGATCAGACACGACGATATTTTCACTTGAGGCCACGACCGAGAGCATTATA
TCAGCACTCATTTTCCCACGATAATCTTGAAGGCCAGTCCAAGCACTTCCAGAAAGGAAACATTGAGTTTCGAGGTGAAATGGAGGAACGAAATCCCGGT
AATTTGGTCGCATTTCACGAGCTAGTGGCGCAAAACACTCAGCCGTACACATTCAATCTCGGTAGCAAAAATTGGTCGACTGCAGAAGCGATGCAAAGCG
AACAACTCAGAAGAAAGGAGATATCGACACCTTTCGCGAAATTCAAGGGTACGATAGAGGCTCGAGTACCGACAGCACAGCCAGTTTCGACGACTACACA
GCGTATCAGTGATAGTACGGCCGTCACACATGAGGTCGCACCATTAAACTCGTCAAGACAGAGTGACTCACCTAGTGCATCTGCAAAGTTGAAAGCTACC
GGGCCAGATCCAACAACTGACAACTCCAGTTCCGATTCGTCGAATGCACTCGATCCGCAGACGAAAATCAGAAGCAGCGATAGTACTCTCAGAATCTCAA
GCGCAGCACCAGGTTCATTCTCTCATCATTCCGCTGCTGTAGGTGACATATTGCCATCTCAGGTAGTTACTTCGACAGTCGTCCCTGCTCAGCCATTTCA
GGCTCAGCATCCAAAACAGCGCCAGTAGGAGGCAAGAAGCGTTCAATGAAGGAGGCCGACGCGAACGGCGGATGCACCTTACAGTGACGGCTGGGAAAGC
ATTCCTGCTATCCACTACGTGTTGCTCTCGTCTCTCGCTCGGAAGAGATCTCGATACGTCTCTTGCGTCTCCAGAGGTAATTTTGCCAAATAACTCTGCA
TGATGTCCGGCCCAACTTCAGCGTACATGACTAGAGTCAATTGCTCTGCAGCCTCTCGAACGTGTGGGTTCGAATGAAATTCAGCGTCGCTCCGCAGCAA
GAAGCGGAATATCCGTCGTGGTGCAATGTCAATGCTTGCGCAGCAATGGAAGGACTGCAATAGTGCCGAGATGAGCTTGAGAACTGCGTGGAGAACCTGG
CCTATGAGCCGAAGCTGCTGCTTTTCGAACTTCTTGAGGA