Description :
From Genome Similarity Track
Location :
Scaffold_1158:4539- 8479
Sequence
3940 bases(100 bases per row)
TTCCATCTCCCATTGCTGTCCAGATCCATGAGCCACTTGACTGTAAACACATTGGGTCTGAGGGCAAGAAACTTGTTCCGATCAGGAAATAGCATCGTAT
ACAAACACCGTAAGGACTCCGAAGTTCGCACACGAGAGACTGTCAAATATATGTGCTCGAATTGCCAAGCCGGTGCGTTTCCCGAGCCTTCTAACAAGGC
AATGACGCGATCGAATGTGGTTCCCTGGGCTTTCCACACTGTTGACGATAAGGTCATATCAACCGCATGCTGATCGTACCGTATCGGCTTTCCATCTTTT
CCAGAGTCATCCAGCTTGATCGTGAAATGGTCGCCATTTGATTGCACAACCCCTATTGGAAGTACTACATACTTCTTATGCATTCGCTGCCCACTTCCAT
CATATATCCATGAAGACTCAAGGTTTGCATGACCCGGTGCTCCATATCCAAATAACTCTGGGTGCTCTGCTTCATTGTATAACAATTCCTGAACAAAGTC
AGGAACGTCGCCCCGAAGGGCTTTCGTCATCGAGATAACAAATTTTGACTGCGGCGAGCCAATTCCGTTGCCATACAGGTGTTTAGCACTGCTCTATTCC
ACGTTACTAGTAACCAATATGACAGATCCATTCATCCAGCTCTAATCGCCGACTGTATCTTGTCGTGTTAATGGTCGCGTTAGCGCAGCAACCATACTTT
TATCAACCTGACGATAAGGCGCGCCGCCTTCGCTCCACCAGTTCTGCTCGGGGTAGACGCTATGCAATCTGCGAAATCGCTCGAGTAATGCTTGTTGTGT
CCGACACTCGCTCGCACGATGTTGCTTCCGCAAGGTAGATACGGTAAACAGGGAAAACAGGTACCTGGCTCGTAGTAAGACAAGATCATGTGTTTGCATA
TACATGCACTTGCAAAGTGAAATACCTCTGACGACCTGAAGCTGCCAGAAATCACCTGTCTATGAAAGCATTCATACAGATGTGTTATGTTTGCGCAGCG
AATCATAAATAATACAGCGGTATAGCGTTCCAGCAAAATCGGTTTACCCCAAAGGGTCTATTGCTGTCGTACAACCCTCGAAGTCGTTCATCCAGCAAAA
CCAGGTGCTTAGTCTTGAACATGGAGATTTCATAAACTACAACAAGTGCAACACCCAGGCCAAAACGTTGGCTCAAGAATGCAGCCGACTGTGCCGATAA
TCGGTTGCCTTTTTTGCTGCATTTTAGAGCAGAATGCAAGGTTCTCCATTTTATAAAATGGcatgctccagcaccagtcgGGCATGCGGATACAACCTCA
TATCGGCGCTGGTTAAGTTCTTGGCAAATGCGCCGTACTACAAACGACTTTCCGGTACCCCCGCCACCATGCACTACAGAAAGTGGTTGTCCTTTTCCGC
TCCGGTCGATACCGTCAAGAATCATTTTCACGACTGCAAGCTGCTCTTTAGACAATTCGCTCAAATCAATGATGCATTCCTCTCCAAAGGGGTCTTTCCC
AGCGCTGCCTCCGCCACCCAGTGACTTAATGTTAGGACCGAGTTCATGAGTTTGAAACGTTTGGATCGATACAGCAATCCTGGATAAGCTGCGTATGCCA
CAATCACGGGTACTCGCGGTAGCAAATTGAAATATTGGATTCGGCGAGATCATTGTATTCGTATCCATTGGAGTTGGGTTTTGggcgtcatcatcatcac
taACAGCACCTTCTACAAACAAAACGGACGAAAACATCGACTTTACAGATGCAATACCGGATCGTCTAGTACCGAACCGACCGTAGTGCGTGTAAGGAGT
TCAAAAAGGTCCCCCTTGGACGGTAAAATCCCGCTAAACTCTGGGTCATCAACCCGTGACGATGCACCGATATGCGCTTGATTTGAATGAGGCTGAGGTG
ATTTCCAGTAACCAACTCCTCGATTCTCCAATCGCTAGCTATCTATTcgttgcggctgctgcgataTCCCTTTTTCATTAGGTTTCTAACATACCGACTG
TGTTCCCTGTTTATAATTGGTGCCGATCTTCGATCCCATGAATCACACATATCCAACAAACCTGTTGAGTCGAACGACCACTTTGGACTCCTTGAATCCC
ATGACGTAAACGCGCATAACAGATAACGAGCAATTTTATCGCACTTCCTcgtgtcgctgcagctctcaTCAGAATTGCTCCATGTGGGGGGCGGAGCTCC
CCCAAATACAGGTGTTATTAGCTTTGCACGTATAAAACCGAGATGCATTCCAAAGAGAGGATGAGATGGCCCAAAGGCAAAGCCGTCCCGCGCCGACCTC
CCAGCACCATTTGTTTTATTTCTCGGTGTTTTGCTACTGGAAGAACGTCAACCATACACTCAAATTCCATTGAAGAAAAGTCCACGGAATTATGACCCGG
TGATAGTATGATTCGGCCTGCGTCGGGAAAATAATTTCCCCACCAGCTTTGAAAGTCCGGACACCGCTGCTTGCGAACGGCCGAGTCGGAATAGTGTTTG
AGTAGTCTTCATCATTGACCTTGTCAACAAGACCAGCTAATTCATCTTCAACGCTGAGGGGGCCTGCATCCGTCATGTCGTCTGTCTGACCGGCAGCATT
ATCTTCACTACTTCTCAAACGCTTTACGTACTCTACAAGCGCAAATGGAAAGATATACCAGAAGGTGTCACTCGATACAAATGATCGATGCCCAGTTACA
GCATAAACCATCAATGCGTGGGGCCACTCGTGTGCTCCTGAAAAACTGTTGACCGTTCTCGTTGCTAAACATTTCCGATTCGCAATTCGGAGTGAGAATC
GTCTGCACGACTAGGGTCCTTCACATTGTGATCCACGGAGCTCAGTAGCGCTGACGAATCACCTTTTAGCGCCGCATCATCTTTTGTCTGTTGGCATTCC
TCGATCATATCACCAGAATCGTCGCCATTAATGAACGACGAGTTCGTTTGTAAAGCCGTGAGCGCTGCAAGTACGAGATTGATTTCAACGACTTTAGTAT
CGGCCCCCGGTCTCGTTAGCTCTCACAGTAATGGCCCTTCCCAATGCGCATGAAAACTTTCACCGCTAGCGTACGAATAACCGTCAAATGGCACGGAGTA
TATGCGATCGCAATTTGTGACCGATAGCGATAGGGGTAACACTGGCGTGCGCATTGCCTTTGCGCTCTCGTAGTACGAGTAACGGACATGTCGGCCCGTC
ATGTCGTCCAGCGGGTCTAGCCAGCCGGCACATGTATTTTCCCCTATTTCCTATAAAACAGGTACTAGTCTGGGAATGAAAGTTCGTAGTCGCGGCACGC
ATTTGCGCGGCCTTAAGAAAAGCCGCGAAGTCAGACTTGGCATCTGGCAGCGAGATCTCGAAGGCTTTTGGCAGTCTCCCGACTTGAGAAAGGCAGGTTT
TACGCCACTCATGCACCTCGCCGTCAAATCTTGTGCAGCATACTGACTCTAACCACCGGGCAGCGCGCTTACATAGCACATGAGAACGCATGAGCCGCGA
TAGCAACGCTGGGTTAAACTTTGAACCATATAAAGTCATGTGTATGTGAAGCCTTCCATCAATTTGTGGctccacgacggcggcaaACGCTGCTATCGTC
CCGTATGTGCCCACTTTTCTTTGTCTGTAATCACGTGAAAATCGTGTATCGCTTGCTACTTTGCAAACCACGATGTCATTAAAAATCTGCTCTGTACACC
TGTCAAACACGCGCGCGGCTAAAGTAGGATAAGTATTCGAAACAGCTAGCCTTTCGCGGGTACCCAAGCGAACCGAATCTGGCAAATCATCTTGGCAGCA
CTGCTTCCGCTGAAAAATAATATTAGGCTGATTCCAGGCGTTTAGTTCTCGGAGGGCAGCAATACGATGTAATTCGAGATCACGATGTTCCGGCGGCGCA
ACAGTAACCCAATGCTGAGGGGTTCCAAAGCGCGCTCTCA