Description :
From Genome Similarity Track
Location :
Scaffold_24:45389- 47006
Transcript NameFunction/comments
Phypl_g1009hypothetical protein

Sequence
1617 bases(100 bases per row)
CTAATATAGATGACGCAGGGCAAGGTTGGCTCGCGAGGACTCACTGTACTTGAGGTTTATTCGAGTTATCACTGAGAGTGTCGCAACGAAGCACCGGTGG
ACCGGCTGTGCTTCGTCCACATCATGCACGGCGGCAGCTCTGTCCGCGACTGCGTGACCCAAAGCGTTCACGAGGAACTCCAGCATTGCCGCACGCAGTG
CACCTGTCCACGTGTGTCGAAAGCGCACTGATCGCGAGATACGCCGCCACACATGCTGCCAGCAAAGAATTTCAGTCAAGGCTCGCCGCCATCCGGAATG
ATCGCGCGAATGTGTGCAGAGATGCTGTCAAGCGTGGATGCCAAGTCGACGATGGCCGGGAGACAAGCCGCGTGGTAACTTGCGCCGCTGGCAAACGTGC
GGGTTGAGCAGGCGAAatgctgatgctgccgcagcggACCAGGTATAGCTAGTTCATGGAGTGCTGTAGACCACGACAGCGATGTGTAGTCGATGCGCCG
CAGAGAAATCGCGCCACCGGAATGAGGGCCCCTCGAAAAATGAACAAAAgccgcgccaagcagctgaTTAGCCTCGTGTAATGTccgctggacacggcgg
GGAGAGTGGGCCGGATCTGCGTCTATGTTCGGCATGACGAAGTCTCTCACTCGGCACAGTGTCTGAGTAATCTCGGGGTACCAGCGAACGACATCAGGTC
TAAACAGCGGTCAAGCGGTCATTGAACAATCGACATGATGGCGGTGCGGGGTGCTTCGTAGCGCCCAAAATCGAGGGCGAAGCTGGCGTCTGAAAAACCT
GTTTCGAGCACCGCTTCCCGGTTGACCCGGCGAAAATTCATGATCAACACGCGAAATCTGCCGAACCGGACGTAGTATAGTGCGATCAGAATGAGCGGAG
AATCCGCGAATGTCATAACTGCAACAACCAGGACCTGGTAAATACAATGCTCAATTTTACTATACGTACCGAGAAGCACATAATAGTCACTACAATGCAA
GACGACACAATAATAGTTGCTGCAAGCACTGTAATGTTTGGCCCGCCATTACATCACACACTCCTTGGTCTCTTCACCGCAACCAAGAAGCGTCGCACTG
TTCCAGAAACCACTATTAGGCCGCAAATGCATCACTGTCTCGAAGTTCGCCGGCAATGTAGACGAACGCAACGAAGTCAGCACCAACTTGCTCTCCGAAA
AGAGTCGTTCGCAAGCGTTGCTAGTCGGAGGAACGTGATGCAGAATCAGATCGTACTCTACCGTAATACGATCAGACCGGCGCAGTTTCTTCACTTGCCG
GGGTATACTTGAGGCAAAGTCGAGTCGAGCCCTTGGCGCTGGACTAGGCTCGCTTACAGGCAGTACAAATACATCGAACGCGCGCTGCTCACTCGTCGAC
AGCGGGGGCTCGTTTTGGATCTTGACAACAGACGCTTCAAAGGTGGGGGAGTGCACAATGGAGGCACTCGGCTTCAAATGCTCGCCCATAACCGAGTGCT
TCTCCGCACACGCGTCGAATAGTAGACGCACCTCCACCATCGTGCACTTCTCAGCCTGCAACTTCACGTAGACGCtgtccagctcttccagcttgtccac
gacagcagcgataCGTC