Description :
From Genome Similarity Track
Location :
Scaffold_158:45378- 47750
Sequence
2372 bases(100 bases per row)
AGACGAGTAGGATGATTGGATGAACACCGGTGAGTGATGGTTGATTAGATGCACTAGGTGATAGGACGCAGGGTCGCGTGTCTATAACAGTAGGGTGTAA
GCTCCAACAATTCAATCACTTTCGAATCTTCATTCTACCCCTCAAGTGCCTTCGCTCCGGTCCCGCCGTCTGCGACGTCCCTCCCTCCGCTTCGTCCGAG
CTTCGTGTCCAAGATCCATACCTTCCATCAGGGTGCACCACGATCCGGTCCGGACAACACGAGGCTTCATCGAACAGGGTCTGTGCGCGTGTGATCATGT
CTGGTGGGGCGATTCAGTGGGGTGGTCCGACAACTTGACTGATCCAATGCAGGCAGTGGCCAGGATACGTTCGCTGGCCACACTTTCGCGCCTTGGGCCT
ATCCTGCCGTTAGGGAAGTCGGCGGACGGACAGGATGCGTGACTCCCCACCGAATATGAGCGCTCATCCGGTGGGCGCATCTCCAATCCTGTGAGCCCAT
GCTTGCTGCAAGTGCCGGGTCCCACCAAGTCTCCACACACATCCACAATCCACACGTCACACTCGTCTCTACCGGATCTCCATCTCATGCGACCAATCCA
GCTCACCGAAGGGTCCACGTATCCATGGGGTCGGACATGGGTGCAGACAAAAATCTGTTTCCACATCGTGTCATTCGGCTTGAAGAACGCTCCTCAGATC
TACCAGCGACTTCTGGACGACGCGTTGTATGGGTTCACCAGGATCCCGCGATCGTCGGACTGTGAAGTCACTACGGACTTGGTCGAGTCAGGAGAACCAG
AAGATCCGGGCGTCCATCAGTGCTAGGTCGCAGATCGTACATTGACGACATTTTGGTGACGGCCGGGTCATGGGACGAGCTGTGTGATCGCGTGGATCAC
CTGCTGGACGCTTGTGATAAGTGGAACCTCTCGATCAGTGTGGAGAAGAGCTCGGGGGATGCGTAAGGTGGACTATCTGGGACATCGGGTGTCGAACGAC
GGGCTAGAGGCCAATCCGAAAGATCTCACGGCTCTGACTGATCTGCCGTTCCCCGGATCGCTCCGATCGATGCAGTCGTTCTTGGGCAGCCTCAATTATT
ACAGCCGTTTCTTGGAAGATTACGCGATCTACGCGGCGATCCTGTACGAACTGCGCGAGGTGGACTTCCCCGAGCTGAAGAAACGCCCCGATCTGCGCCA
GATCCTGGATCGTCAAGTAGCGAACTTAGTGGATACGGATCCAGTGAACCCCGATCGGACTCCATCAGTTCCTGAAGTCGGTGTAGCCGATGAACGCTGG
ATCCGTGCTCATCGTGCCTTTTCGACCCTGAAGATGAAGATCGCGACGACACCGATCCTGCGGCACTTCGATCGCGATCGGACTCCGGTCGTGATTGTGT
ATGCCAGTGACTGGGCGATCTCGGCCGCATTGATGCAGGAGCACGACCAGATCTATCATCCCGTTACTTTCGCCAGTCGAACGCTGAAGTCGAATGAACT
GAATTACAATGTGGTGGAGAAAGAAGTGCTGGCGCTGTTACGGATCCTGGACCTGAACTATTACATGCTGGTTGGACGATCGATCCGGGTCTTGACCCGA
CACTCGACGTTGGCGTGGCTGTTCCGATCGCCCGGCTGCACTCCTATCGCCCTGGACACTTGTGGTGGAGTCCCTCACATAAAAACTAATAAACTCCCAC
ACGTGTCCTGTCACGCAACTACGGGGGGGGGGGGGGTTACCCCTGCAAGCCAAATACCCAAAGACAACGAGAACTAGTCCCGAGATCTCTAGGCCTCACC
TTGTGTACCCTTGTAGCAAGACTCGGATCTTTATCTAGCGTAATTCCTAGAAGACGTGTAATATGAAGGGGTGAATATGGGGTTCCTTACACTCGCAGGC
AGAGACTTAGGTTAACTCTGTCGCGGATGCATTTGTACAGCGAGGTAACTCTTCCCACTGTACGACAACTTGTTGTACAATACGTACGAGATCTACTGGA
GATCTCCTGCCGCAGCTAGTCTGCGGGTCCAAACCAAAGTGCGAGACGCACACCAATACCTTACTAAACCGTTTAGAGTGTCCTACTGTCGAACACTGAG
AGCTGATCTCCTGAGTCCAGACAATGCAACACACTACGCTACTAGAAGGTTACCGGGGAGGCCAAATCAATCCAGAACCCCGAGTACACTTCGCAAGTAG
GTAGGAAACAGTCACAGTACACACGTAGGCGCTAACCACACAACACAAAGACTAATATGAAGAAGTACCTTGTCTCGTTGTTGGAAATTCTGAACTGAAC
TGCCTATCTACCGGCAGCTCGTCTGCCGGCCAACCAACCAACCAGTATGCTGCACGCCTTTACCTCATGACG