Description :
From Genome Similarity Track
Location :
Scaffold_1439:4537- 6471
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1439-snap-gene-0.2Cysteine protease family C01A
Pytir_DAOMBR486maker-pir_contig_1439-snap-gene-0.3Fumarylacetoacetate (FAA) hydrolase

Sequence
1934 bases(100 bases per row)
GTTGACTGGTCGAAGGGTCCTTGCGTGTCTCCGATCCAGAACCAGGGCCAGTGCGGCTCCTGCTGGGCGTTCGCGAGTATCGCGGCGGTGGAGTCGGCCC
AGTGTATCGCTGGCGGCCAGAAGTCGCTGGTCAAGTACTCGGAGCAGCAGCTCGCGAGTTGCGACACGAGGAACTTTGGTTGCAACGGCGGCGCTCCGAC
GTACGCGTTCGACTACATCCAGAAGAACGGCGTGTGCACGGAGACGGCGTACCCGTATACCTCGAGCAACGGCCGCAACGCCGCGTGCACTGCGAGTTGC
CAGAAGGTCGACGTGGGCATCAAGGGTTCGGCCAGAGTCTCGGGCGAGGACGGTCTCCTCAGTACTCTGGCGCAGCACCCGGTTGTCGTGGCTGTCGCGG
CCGGCAACAACGCTTGGAAGCAGTACCAGGGCGGCATTCTCTCGGCCTGTGACACGAGCCAAGTGGACCACGCCGTGTTGGCTGTCGGCTACGACGGCGA
TACCATCAAGATCAAGAACTCGTGGGGTGAGCGCTGGGGCGAGGCCGGCTACATCCGCCTGCGTCGCGGCGTCCCGGGCGTCGGCACGTGCGGCGTGTTC
ACGGACATGTCGCACCCGCTCGTCTAAGTGTGAAGAAGCGTCCAAGTACAAGTAGTATGTGTAGATCAATCCATCCTCGTCGCGCCAAGAAGAAGACGAG
CGTTTGGTCTTCTCTGTGTGTGGAGTGTGCCTGTTGTAATAGACTCGAAAACAAATCAATGACAAATGACAGTCGTACGCATGATCCAGGTTTGTTGAAT
TCAACCTCCATAATTTCAAAGCCATTTTATTTCCAATATAATACAAATTATACATATCATACCTCTTATATGATAAAAACAAAGCCATTCGTAAAGAGGT
TTGGATGTGAGATGCATCAGCCCCACACATCAACATCACTTTTGCATTTGTCGATCAAGCGTCAATCAATCAGAGTTGTCTGTGGATGCTGCTGCTGTCG
CGCCTCCGCTCTTCCCCCCTCCTGCTATCGCGTCTCAACTTCCGCCGCGCCATCTCCATGAACGTCTCCTTCTCCACGTCGCCCAAGAAGCGAGCGACCG
CGGTCGTGCGCTTCGTGGACNNNNNNNNNNNNNNNNNNNNNNNNNGAACGGTGCCACCCGCTGCGGCCAGCGCGAAGCCAAGGACAGCGCCACCGTGCGT
CTGGTCGAGAACGACGACCCGCTCGGCAGCCTGCTGTTCACGGGCGAGCGCGCAACCATCAAGAAGCTGTTGGCACCTGTCGTGCCGTCGCAAATCCTCT
GCATCGGCCTCAACTATCGCAAGCATGCGCAGGAGACCAACATGCCCGAGCCGCAATACCCTGTGCTCTTCTCCAAGGGGCTCAACACGCTGCAGCACCC
AAACGATCCCGTGGTGATCCCGCGTATCGCGTCGAGTCCTCCAGAGGTGGACTATGAGTGCGAGCTTGCGGTCGTGCTCAACGAGACGATCAAGAACGTG
AGCGAGCAGGACGCGCTCCAGTACGTCGCTGGATACACGTGCGCGAACGACGTGTCGGCGCGCCGGTGGCAGGGTGCCAAGGGCGGCAACCAGTGGGTGC
GTGCCAAGACGTTTGACACGTTCTGTCCGATCGGACCCGTGCTCGTGACTCCGCAGGTGATCCCGGACCCGCAGAATCTCAAGATTGCGACCTACCTCAA
CGGCAAGTGCATGCAGAGCTCGTCCACGGGCGACATGATCTTCTCGGTCGCGCAGCTCATCAGCCAGCTCTCGCAGGACATCACGCTGCCAAAGGGCACG
CTCATCCTCACGGGCACCCCTGAAGGAGTGGGATTCACGCGTAAACCGGCGGTGTTCCTGGCTCCGGGGGATGTTGTCGAGATCGAGATCGAGAAGATCG
GCCGTCTCGTGAACCCTGTCACGGCCGCCTCGGC