Description :
From Genome Similarity Track
Location :
contig_38:45366- 58548
Transcript NameFunction/comments
g8306.t1RAW38029.1 hypothetical protein PC110_g5737 [Phytophthora cactorum
g8307.t1XP_009515579.1 hypothetical protein PHYSODRAFT_537011 [Phytophthora sojae
g8308.t1XP_009515578.1 hypothetical protein PHYSODRAFT_353509 [Phytophthora sojae
g8309.t1hypothetical protein
g8310.t1hypothetical protein

Sequence
13182 bases(100 bases per row)
AAGTTTCCCCTTCGAGAACGCTGCTATCTCAGTGTTGCTCATTGCCCTCCAAGCACCATTGTGATGCGCTCCGGACGTCGCTTCGTGCCGGTGCGGAAGT
GAAGATGCTCTGCCGCATTTACCCGTGTGTACACACTGTGGTAACGATGTTGCCGAGGACACGAGGCCTTCGGTCTGTGCTGTATATAGTCTGCTTTGCA
CCTACAAATGTTTCCAATATAGGTAACGAAAGAGCTCTTCATATAAATGAATGCTGAAAAGAGTCGATACATGTAGTCATAGAGAATCTGTGTCCAGGCG
AGCTGAAGCAGAGATTCGTCAACTGTCTCCGAGTAGATGAGCCGATTAGAATGTATTTTCGCCCCAGCGAGCTCACGTTTGAGCCCAGTTACAGCTCGCA
ACGGCGAGCATTTGTCAAAATCTAGGGTGATCAACCCCACCTTCAGCAATTCAGCTCGGACTTACTGTAGAAAGGGTTTTCACCACTCGCAGTGATCCAT
TTACTGCAGCATCTTTGCCGACATTGCTCAAAACGTGTTGGATCCAGGTCAGTCTATGGATAGACCCAACCAGCTCGGGGCTCTGCAAGCGTGAGTCAGG
CGGCCACGCCTTGCGCCAGCGATGTGAAGCAACTGGTTTCTAACGATGGATGTTTGGCTGACGGTCGATCAGCACAAACTTGGTCACCAAACCGAGGCGA
TCACGTAGTCAACGCGTGCATTCATGCAGGACTATTCCAGTGATGCGTCTGCAAAGGCAAGGACGAAGGCGTGACTCCGTTGTCGTCGGCAGCTTGATGC
TGCACGTGTGCCGGCACCGGACCGCAACCTGAAAACGACGCATCCCTCCGCGCCACAAACTGCACATTTTCACCACCGACCAGGGAGGATGGGCACTTCA
AGTTGCGCAAACTACCGAAACTTGTGTGCACCACTCCACTCCAGTAATCAGGTCAAAGCTCGTCGACGTCATTCGCTCAACTTCCTCGCTACGACCGAAG
CCTCCCTCCGCCATGTTGACCCGATTCCCCCAGCGCTTGCGTCTACGTCTGCAATCGACAGACGCCTCGCGCGCACTGAGTTCGGCCGCTTCCTCGTCCT
CTTCGTTGAAAGTTCTGATCATCGACGGATATTCGCCCGATGGCCGCGCAGACCTGGAGGCTGGTGGCGCCAGCACGGCCGGCAAGCTGTACGTCAATCT
GTTGAACAAGTCGGCGCCTGCTGGAATGAAAGTCGCGTCGGATATCGTGTACCCAGCAGACAGCGATTTCAAAACGCCCGAACTATCCAAGGTGAGCTGA
CCGCTTGAATCTTCATCATTTCGTTGAGATTGTGGCAAGAAAAACTGGCCAAATTGTGGAATGCTCAGAGGGTTATTGAGCGAAGAATTGATTAAACGTT
GCGTGTTCGTTGACAGTACCATGCAGTGGCGTGGACAGGATGCTCGCTGACAATTCATGATACCAAGGACGTCCGTGTTACCAAGCAGATCGACTTCGCC
CAGAAGATCTTCGAGAAAGGTGAGGGTTCAATGGACGCAGTGGAGGGGTCTTTATCATGATTAAAACAAGGCACTAATGTAGAGTTACATGCTGTTACTA
GGCATCCCGCAGTACGGTAGCTGCTGGGCGGCGCAGATCGCGGTGGCTGCTGCCGGAGGTTACTGCGGGCCGAACCCGCGTGGTCGTGAGATGGGCCTTG
CTCGTAAGATTGCACTGTCCCCCGAGGGTCGTGCACACCCGATGTTCGAGGGCAAACCGTCGGTTTTTGATGCATTCACTAGTCACAACGACGAGGTGAC
CCACATGCCTCCCGGCGGACTTGCGCTGGGTGGCAACGACTTCACGGCGGTACAGGCCGTGGCTGTGCGTCACAAGCAAGGAGAATTCTGGGGCATTCAG
TACCATGCTGAATATGATTTGCACGAGCTCGCAAGGCTCACGTACTGCCGCAGAGAGAAGCTTGTGGGTCTGGGTTTCTTTTCCGACATGAAGAGCGCTG
ACCAATATGTGGACGACCTTGAGAATCTGCACATCGATCCGTCTCGTTTCGACATTGCGTGGCGCCTTGGAATAGATGCCGACGTCATGGACGAAAACAT
CCGCCACTGTGAGACGCGCAACTTCATCAAGTACCTTGCGCTTCCCTACAAGGCGGTTGTCGAGGGTAAATAGGCACCGTTAAACCGCATTATTGCATTG
TATCGCGATACAAGGAGGTAATAGATGGTCAAGTGCTCACAACTTTAATCGTCGATGGAGATTATTGATAACCAGTCGCTTTCAAAAGTTCTCAAATCGC
TTTGTATTAGCTCGCATTGGCAACAAGAGAGGATATAACCCCTCATTCCGGCTGCTTATGTAGAAATTTGCTGGGTGCATGCGTTGCCTTGGTTCTGGCA
ATAGCTTTCAGAGCTTTGTAGTGAGATACTAAAGGCGCAATCTTCACATCAGGATGCTACAAGCTTAGTGTCGTCGATATTGTGGCGATTACTTTGAAGT
ACTTTTAAGTGCACTACACTATAGTACTGCATGTACATGTAGTAGGAAGTAAAGACCCGGTGCCACAATAAAACTGCTACTGGTACGAATCTTGAACGTC
CAGCGCATTTGAGCTTTAATTCGTAAGTCCGCCTGCCACCGCTCAGCGCTCCAAGTCGTATGCGCCGAGTGTCAGCTCTCAAGATTCATTGCGTGAGTTG
CAGTGAAGTCTCAAAAGCTTTTGCTGTTTTCTTTCGCTCTTTGCAACAACTTCGCAAGCACCGGTACTCCATGCAGTAGTTTTCAGTTTCGTAAATGACA
AGCTAAGAAATCATTGTTCAGTGGTTAACACGTTGAACGAAAATGCACGTGGATAAATGCAAAATGCAGAAAAGCTAACTTGCTACCCACAGAAACCACA
GAGAGACGAGACGAACGTCAAGCGCAATCAAAACGTGTTGTAAAGACGTCGAGATCTCGCCTGGCCCCGTTATCTACAGCGTACGCTTACTGCTTGCCGC
TTTTCTTCTTGGCAGCCTTCTGCATCTTGACGGCCTGCACATTCACCTTGACATCGCGGGTGAAGGGCAGGTAGGTGACGCCGCCCATGAAGGGGACCAG
CACCTCCGGGACCTTGACACCGTTCTCGTCCTGGCAGTTCTCTAGAATGCAGCACACTGTACGCGTGGAAGCGCACAACGTCGAGTTCAGCATGTGCACA
TACTTCTTCTCGCGCTGGTTCTCCTTCTTGACGCCGCAACGAATCTCCATGGCACGCGCCTGGAAGTCCGTGCAGTTCGAGGCCGACACCAGCTCACGGT
ACTCCTTGTAGGCAGGGAACCACGCCTCCAGGTCGTACTTCTTGACAGCAGCGTTGTTAAGCTCGCCCGACACGATGTTCACCACGCGGTACGGCAGGTT
CAGCGACTGGTAGAACTCCTCGGCATGACGCAGCATCTCGTCGTGCATGGCAGCAGAGCTCTCCGGGTCCGTGATGCAGAACTGCTCCATCTTGTCGAAC
TGATGCACACGGAAGATACCCCACGTATCCTTGCCGTGCGATCCAGCCTCTTTACGGAAGCAGGTGGAGAAGCCACCGTAGCGCAGAGGCAGCGAGCTCT
CGGTGATCCACTCGCCCTTGTGATAGCCGCAGATGGGCTGCTCGGACGTGGCAATCAGGTACTTCTCGTCCTCCCCGATGACCTTGTACAGCTGCTCGTC
AAAGTCGTCGAGCTGCGCGACAGCGGCCATGCACTCCTTGTTCATGAAGAAAGGCGGCTTGAGCATCTTGTACTGGGCCTTCATAAGGAAGGCCGTGGCG
TAGGCCATGAGCGCCTGCTCCAGCAGGAAGCCGTAGCCCGTGAGGAAATAGGCGCGGTGTCCAGCCACCTGCACGCCGCGTTCGGGCTCGTAGCCATCGA
TGCGATGCAGCACCTCGTGGTGGAAGTGCAGGCCGTCCTTCTGGATGGGGGATCCCCACTTCTTGACCACCACGTTCTCATCCTCGTTGCTCGAGACGGG
CACAGTGGGGTCCACCACGTTGCCGATCTTGGGCAGCTCGCGGTCCAGGAGCAACTTGAGCTCGTCAGCCTCCTTCCTCTTCTCGGGCAGCTGGGCAGCC
AGATCCTTGCGCTCGTCGCTGAGGGGCTTGAAGTCCTGCTTGGCCTTGCTGAGCTTCTTGATCTCCTGCTGCAGCGCGTTCATCTGCATGCTGATGGTCT
CCACCTCGCCCTGCTTCTTGCGCCACTGCTCGTCCAGCTCGATCACCTTGTTCACGATGTCCACATCTAGGAAGCGCTTCTGCTGGTCGGCGCGCACGGC
GTCCGGGTCGCCGCCACGCTCGGGACGCAGGCGGTTGATGTCGATAGGCATGTTGGAGTGCTTGGCTGAGGGTGCGTTGCTTTTCCACGTATGAGAGCGG
GGGCCATCGAAGCGAAGATTCGCTCCAGCCACAGGAATAATCCTGGTCGGGCCTGAAAATGTGTAGTCGGTGGCGCATTAAGTAGCAACTAATCAGAGGC
GGATATTCTTATATAACGTTTAAAACTATGAAGTATTATGTTTTTACTTTAAAAAAATATAATAAACGGTGAGAAAGTCGAAAGCGTGCGTTGTGAGGGA
CAAACTAATTTCCAGCACCTGGCACTGTCGTCGTCGCCACCCGACGAACCTGCGCCATCCTCGGAGACATTACCGGTTAGACCCTGCTTACCTAGTCTTC
GCGGCAGTAGTTTTGCTTTGATGCGTCTATATTGAATATGTGCGGGTTGCTTGCTTTCCCTGCTGAGAGCCCTCGGTTAAAAATATTGTTTTGTCGTAGC
AAGAAGCAACCTGGATTCATAAAACCACTTCAAAGTTTCATCATTGCTTGCATATCGGCTGTTGCTACGGAGATCGTCATAGCAGCGTGCCTCGTTGGTG
GTGGCGCTCCTGCGTGGCGGCGAAACGATCCACAACTGTGTTGGCGTTCGTGGCGCCTTTCGTTAGTGTGGCCAGGTACGAAACCAACAGAGCGTCGTTG
TACTCTTGCGTGAACGCCGCGTCGAAATGCTCCGACTTCATGGCGGGCAGCTGATTGCAAATGCTCGAGATGTGGCGCAGCAAGTTGTGGTCTAGCGGGG
CCTCGCCATCTTTCATGGCCTGCAAGAAGCGCAGCAGCACGTCAACCTGACGGTCCAGCATCTTTACAGCGTCTCGGACGTTGCCCAGGTACGGGTGCAC
TGAAGCAGCGGCAGCGAACGTTAGGTTAGAATGAATGCCACATCCAAACAAATATCCTGAAGACGATGCACTTACACGACGACTTGCTCGCATCGCCAAT
CGGTGCGATCTTGGAAATGTGGTCGATGGCGATACCTTCGGCTTCGGAGGTATCGATTTTGAAAGGCGCCTTGACAAAGATCATCTTGGGCACGCCGTTC
AGCATGTGCAGCTCCGACTCGAATAGCGAGATCGGCAGCTTCTTCTTGGTGCTCGGCCCCTTGGCCTCGGGGTCTAAGATCATGAACAGCGGGCTCTCAT
TGAATTCCATCACCTGTACGATAACCAAATACCTGTCAGGCCAACCTTCACCATCTCTACCAACCCACACGCCCTTCTCACCACGCGATGCACCGCCAGA
TCACTGGGCAGAGCCTTAGCGCCCACCGTGTACCACCCTAGCAGCTCAAAGCCCGGGAAAACCTGAGAAACTGCAGCACCGCAAAACCCCGCGTCAGTTG
CGCAGTCTCCTTCCTCTTAGCGTCTCCACGTCGTACATTGCTGAATGCGCGAAGTGAGGAACTCCTTGTCGATCTGAATCTCTCCACTGGCGCCCACATC
AAACTTCATCTCGAACGAGTCGTATACGTCCACGTCCAGCCCCTTCTGGATACCGAAGAGCGCGCCGATGACCTGCGGCGCCTCCGTCTGGCTCAGCTGC
GAGTTGCACTTCTGCCGGGTCTGGTGGTCGGCGATGTTCACGATCACCAGCGGGTGGATCTGGATTTGCCGCTCGCCTCCGCCAGCGCCGCTGTCCTCGC
GCTGCACCAGCATCTCCTCGTCCTTCTCCTCTGCGCTCGCCATCTCCGTGTCCTCGCGCTGCATCTCCTTCTCGTGTTGATGTGTGTCGACGATCCTTGG
TGTAACGTGGTGTGTTCACAAATTCGGTGACTTGACTGTTGTTGTGGTGTACGCTATATGGTGGCAACAGTTGGACCGTGCCTCTAAATGATGTACGATT
TGTGTTCATACGTTTTTGCACTCAATTGCCGACATGACGGCACTGAATAGTCAGTGACTATTCCGGTAACGCCAAGCTCGTTGAACAGGCCCTCAAGAAA
CGCAGTGCCGCGCTGAACCAAATCCCCCCTCCGTTGCAGCATCGGAACAACGCAAACCGCCGCCGGGGGCCGCCGCCAACATGAGCGACCAAGTGTCCGA
CGACTTCATCTGGTCCTTGGACGTACGCGACGACCCGAGAGGCAGGAAATTGATACATGACTGACATCTTCTGCGTCCGTTATATGTTGCTCAGAGCCTG
ATAAAGAAGGATGCGGGCGCCGACGTGGAGGGCGACGCGGACCTCGTGCGCGCAAGCTTGTACACGCAGGACAACCTGCTGGGCTCCATGATCGGCAGTG
ACCTGGTATTCGGGCGTCGAGAATCCGCCAAGTTTGCGCAGGATGAGGACGTCGCAATGGGAGGCTTCGGACGGCCCACGGGCCTCATGGGCTACGGTAT
CAACGAGGACGAACTGGATGATGACGAGACAATCGGCCCGATTGAGGAGCGCCTCCCAGCCAACTTGAGCGCCACGCAGCCAAGCAGCGGCAGCAGTTAT
TACGCCCGACAGTCCTCCAGTCAGCTCAGTGAAGACACAGATAGGTCCTTTTCGTTCGCATCGGAGGATGACCACGGCATGGACCCTCTGTCCCTACCTT
CACCGCAGAGGAAACGTTCCACGAGACGATTGAGCGACGGAGATCAGGATACCTATGAACAGCGAATCGAGGCGTCCCTGGCTGGGTACATTACCAAGTC
GCTGAACATCGAGTCGCGCATGGCCGCAGAGGAGCAACTGGATCGACCATTTACAATGAGCGACCTTGCTCATTTCAGTCCGCAGTTCGGGCGAGAGCTG
TATCTCGAACGACTAGGGCAGAGTCTGCAGGAGCAAGAAAGTGGAGGAAAATCGCTGGCTTCGTACCGACGAGCCTCCATGCAGCGGATGTCCACACCAG
CAGATATTATTCGGCAAGGATGGATCATGAAACGCGGAGAAGTGGTCCCTAGTTACCGGAAGCGCTGGTTCACGCTGCGTCGGATGCCGCAGGGACCGAT
GCTAACGTACGCCAAAGACAACAATGAGACCTCTCCAGCTAAAATGATTGATCTTAGCTCAACGTCGCGCTGCGTGACTGTCACCGGCAGGAACGCAAAG
GAGCACGAATTCAAGGTAATGACATCTGCGGATTCCTCGAGGCGTGAATACTGCATGGTGGCAGCTTCCAGCTACGAGATGACGCAGTGGGTGTGCGCTA
TTCAAGCTGCCATCAGTGCCGGAAACAGTTCTACGTTTGACGGCGCCACAGACTTCAAACAGCTATGGCACGAAGCTGGAATCCAAGGATTTTTGGTTCG
ATACGGTGTGCGCAAGTGTAGCTCGCGGAATCGTCTTCAAACACGAGTCCTCGAGCTTAATTTTGCAGAACAAACCCTTACAAACTCGCGACGAGGAGAG
ACCCTCACGACATTTCATTTCACTGATATTCGCGGCATTTCAGTAAGTAGTGTGCGCTCTAGCGGCGAGGAGCATGGTGTCAGTATCGATTTCCACGGAC
GGCATCGATCCTGGCCAATTTTCTTGGATTCGGTGGAGGCTCGAGATGATTTGTTTGGTATTCTGCAGCGTATTGTTGGCAATGTGGTGTCGGGCGAGGA
CCTTGAAAAGCGGTCGTCTCGGTTGACGCTCAAGACTGGTCACCTCGAAACAAAAAATGCTGGGCCCCACGCTACGCTGCGCGGTCGTTTATTTGTCTGC
CTTCACGAAAACTGTATCGTGTTTTATCCGGAAGATGGAGATACCAGTACACGGCCGTGGTATGTCATTGCCCTTAAGGGCCTTCGCGTTTCGGTTCGAG
AAGAAAAGCGAATACTTTATATTGGACGGCTATCGTTAGCGTGCTCGTCCACAGCAGACTGTCGTGCCTGGTATGATGCCATCTTAGCGGCTACGTGCCT
ACCAGCAGAAATTATTGAAATCGAGCTAAAGGAGCGAGCGAAGATCCGCACCGTTTTCCAGGTGTGTGTGTCTCGGCTGCGGAAATTGCTCAAGGCTAAA
GTGACGCCCGAATCGAATGGACCACCGAAAGATCAGAAGACGGTGACTTTGTTGATCAGCAAGCTCTGGGAGCTCGTTTTCCCGGGAGAACCTTTCACGT
CAAATGCCGATCCCAAGTGGTTGGAGATTGGTTTTCAAAGAGGTGGCCCTGCGTCTGATCTTCGTTCAAGCGGTCTTCTTGGACTCTACTGCCTAATCTT
CTTTGCCAGCTATCCGTCGAGCGAATTTCAACGTATCCTGAAGCGCACACGGCATGGTGTGAGTGAAGGTAACATGAAGAATTACCCTCTGGCGATTGCG
TGCATCAATGTGGCATCGCTTTTGACCGAAACGCTTGGTTTGGGCGACGCTGGAACGCACTCGGACGGTTGTTCGTTAAACGCGATGAAGACATACAGCC
TTTTGGTTGCACAGAGTGTCAGTAAGTCGAGGTCTTCAAAACCAGCAAGGGTGTTTTCGACGTCGCGGCCGCTAAGTGCTTACGAATCCTGGGAGGAAAT
TGTCGACGAACCGGAGAACCACGTGTTTGAGACCATCTTCAGCCTTCTCTTCCCGGTTCTAGACTCGCTTTTCGTTGAAATGGGAGCGGTAAGTTTGTAC
CTCGGTGCGTGAAAGGTGATGTACAAGCTGACGGTGCTGTTTGTTTGCTACAGGGGTACATGGAATTCGGTCAAGTCACCATCGCGTTCCGACAGCGCGT
GAATGAGATTTTCAACGCGCAGCCCAAGTCACTGAAGGAGCTTCAGAAGCTGGCGAGCGAGCCTTGCACGGGCACACTAGCGGTGCCGACGGTGTTGCAA
AGTAAGCATCACAAGATAGGGAAGATTGGCTTGGGCAAGAAAATAGTGAGGGCGGGCGGCGTATAGCTACGACGAATGCAGTCTAGTCTTGCCACCCCAC
ATAGAGATTTTGAAACAAAGCCAATAGAAATGCCATCCACTTTGCGCGTTGAAGATGCATTGAAATGAGTTCCCGACAACTTACAGTATAGCATAAACTT
CACGTGACCACAGTCGTGGGTCAGGACGCTCCACCCCACACTCCGATAGATGCGGCGCTGCCACCAACGCTATTTGCTCGCGGTAGCTGAACTGGTGGAG
GAGTACGATGCAGATGCAAATGCCGACCCCTTCCGCCACCACGAGCACCACCTCCTGATCCACTGCCCCGTCCATAGTGGTGGTGGCGAGGTGGCTGATG
GTGCCCAGATCCTCCATGATTCACGGCCGAGCGGGCCAAGAAGCGTTCCCACGACAGCTTCATCTCACGCAGAAGCTGTACTGATTGCTCTTTTGCACGG
CCCAAAGCCTACACAAGAATTTCAACATGTCTGATTAGAAATTCTCGAGACCTCTCAAAAACGAGAATCCTTACCGATTCCGATGTGCTGGTAATCTGAA
TGTAAGCTTCTGGCATCGTATGCGAAGAAATCTCCTTTTTGCCGTCACCCCGACCTTTGCTCCACTTGGCTAGCGACTGTGGCCACGGTCCAAAGTAACG
CAACTGGGCACATGCAATAGCTTCGATCTTTTTCAGGTGGATGCCGCGCTCGCCGAGCAACTTTCCCGGGAAGTTAAACCGCCGTGACACGAGCGCCTCC
GCGTCGACAATGTCATACACATTCACGCGTGCAAAGAGGTGGCCAGAGGAAACAGACTCCTCGCCATCACCACTCAGCACAGCGTGCTTAAAGCTGCTGC
TTCCGCTGCTTTCGCTATCATCTTGACCCATTTCATCTTGTTCCAGGGCTGAGAGTCCAAGCTTCTTCATTTGCCGTCCTCTTTCTTCTAGCACTTTGCC
TTCCTCTTCCTTTCCTTGAAGCCGTAGGCATTTTCCGATTTGTTCTAGTTTCCACGAAGTAAAAGCGTCAATTAATATGACGACAAGTGCATGCTGGCTC
ACGAATTCGTACCAATACAAAAACCAACGTCACGTGTATCTGGGAAAAGTTGCTGACGAATGTCTTGTGCTTTTTTGTAGGCAGCAATAGCTTCACCATA
GCGTTTCTATCAACAATCGCATGTCAATAATCAAACAAAACTGTCGGCTTAATCCACTGCCATACCTGATCCCGATACACACGCGCGAGATTAATAGAGA
TTCGTGCTGCACGGGGGCTGATGTCATTGAAGTATCGATCCGTGATCTGCAGGGCTTCCTTAATGTTTTCTTCTGCTCCACGCCAATCTTTCTGTTTCCG
AGAGAAAAGTTGTAAGAAAGCGGCCACATGCAGAATAATCGAGTTGGTAAACGAGACATACCGCTAGCCGCTTGAAATTGCCCATGTTGTTCAGTGTAGC
AGCGGTCTCAAAGCTCGCATTTCCGAGTCTGCTCCGGCGAATTCGGAGTGCTCGGTTGTACAGACGACCAATTTCTGCTCGCTGTGCTGCTAGCTCCACC
TCGCTGACAACAGCAAACAAGCGTTAGATTGACATGACTGGGGTTTTCGGGGCAATTGATTTGACATACCTCAAGTGCTGGGTTTCAAGTTGGTTCGAAA
GATAGAGCGCCAGGTTGTTCAGCGACTGAGCAACTTGAGGATGATTCTCACCAAGCGTTATCTCTCGTATCTTGAGGGATTGACGATACATGCCAGCGAT
GTCGGGCCGTGCCTCTTCCTCCCCAGTTGTAGTACTCTTGTTCACACCCGTGGTGACACTCTCCTGGCTAGGGCTTGTCACACTTTCGCTGCTTGTACTA
GATCTACTTGGGCTCGGACTAGAGCCAGAACGAGCACCTCGGTGAGCAGTGTCATTTCGCCGCCCACCGCTTTTTCCTCCCCTCATGAGCTTTTCTCTCG
ATTCACGAGCGTCCTCACGCAGTGCCGCCGACGGTGATCGACGTTTACCGGCGGTTGGATAGTTCTTGTAAAAGTTCGCTAAGTTGTTCAGGCTCGTAGC
GTACTCTGGATGATTTTTACTTAGCACCCGACTACGCATCTCAAGCGCCCCTTTCAGCAAGCGCTCAGCGTGCTGCAGCAACCAAACATTATGTGCAAGA
TACCCCCAGCGCGTGCTGAGACAATTGCCAAACTGATTAAGCACTTCAGCCACCTGCGGATGTTCCGACCAGCCCAGTACCTCTCGTTGCAGCCGCAGCG
ATTCAAGATAATGGTACTCTCCTGCAACCCAGTCGGTGACATCGCAACAGGCGTAGCCCAAGTCAGTAAGTAGAAGAGCTTCTAGTGCAATGAGCTCACG
TATTCCAACACAAGTACAGCGATCATGTGCTGCAGCAGCAGCGACGGGAGGCTGTGGTTCCTCGAATGAAGGCAATTTGTCCAGCAGCGACAGCTCTCGA
TCATACTTAGCTTCTTCCACATCCCACAACAATGCTGCAGGATCATTTTCACGGTTCCCACATGTACAATGTAGCGAACGTGTCTCCCGTGAGAGCTGCA
AACAGGAAGATACCACTTGAATACGCCGTCGTGGTTCCACACGCGCGCGAAAAATGAAGCGACACCGAACAACTAGATTACTGTACAGAAGCCCGTCCAC
AATCGAGGAATTTGTGAGCGCTGCAGCACCTGCAGACCGGCGGCTACTCCCGGTACTGCTGCTTGTACTTGCACCAAAGCTACTGCTGTGGCGCTCAATG
GATGGGTTGGGCGTTAATGCATCATCTGTGTACAATGCTGGCTCACTTTTTGATCTCATAGTACTGGTGGAGTTTACAGGAACTTCACCAAGCTGATCAC
TAACAAGCTCTTGTTGTGTACGACGATTGCTCTCACGCACCTGCTCAATGCTCTGTGACGTGAGCTCATGAGCTAACCGCATCGCCGATTCAATATTAGC
ACGTTCCTTATCGAACAGCGCCAACGTGCCCTCAAAGCGGTAGGCATGTGAAGCCTTAGCCACGATCATGCAGTAATAGCGCACAAAACGTCGCTTCCAA
GTGAGAAGAAGCTCTTTACCCAGCGGAAAGCTCCTAGTTGGTGCGCCCATCGATGCCTCAACAAATGATGCAGGTGCAAAACTTGGGCTTGAAGAGAGGG
GCCCTGCGTCGGGGAAACACTCCTCGCCCATGCGGCCAGCTTCTTCTTCAGCAAAAAGCTGCACTAGATTGTGCATACGGTAACGATTCGTTTTCGTGTC
GAACTCCACTAGCGACCATTGATGAAGAATCTCAAGTGCTACACTTGCCGAGGGTACACTCACTTCACGAGCTTTCACCTCTTCGCAGCTCTCTAGATCC
AGCAAATCGTAGCTGTCATTCGTCATTGCACCATCATTGTCGAAGCCGAATCCATCCATGTTTGAAGCTGGGATCCAAGACTACGCACGGAGGAAACGTC
ATCGTCACGACTACGACTTCGGTGGCTCTTGGCGTACGCATGAGCAGGGAAGATCGATGAGGTTGAAGCACTTGAAGTACTAGTGTTAATACCCGCTGAA
CCACTTAATGACGAAGACATCAAAGAGTAGCCGCTACTCCCTGCCAACTTGCCAGCAGCATTCTGCTCCGTCAAAACACTGGAAAGCACAGCATCTGCCG
CTTCGATCTCGAAGCTACCCCGAAAAAATCCAAACGCCATGAACGCTAAGCGCAGTGGCTCGTCCAGGTGACAGAAAGATGAGCGAATGCAGCGATCCAC
ACATTCTTTGTGTCCAACCTGGTTGAGTTCTCTGATTGTTTCGAACCTGTGCTCATCACGCTGGCACACAGAACGAGAAGGGTGTACGTAAGATAAAATG
ACAAGTAAGTCACAGCGAACCCATTCAGGCTTACTTACCTCTAAGTACTCGATCATACGCTCAGGTGTGACTGTCATCCGTGCGTTAGCAAGTGCACGAC
CAACAACGCGAATCGCTAGTGGAAGGCACCGCAAATCCTTGCCAGGCGTTCAGCTAGTTTTGTAGAACAACCAGGGGCGACA