Description :
From Genome Similarity Track
Location :
scaffold_3:453646- 458417
Transcript NameFunction/comments
Plaha_PHALS_14630hypothetical protein
Plaha_PHALS_12743hypothetical protein
Plaha_PHALS_12744hypothetical protein
Plaha_PHALS_12745inositol polyphosphate

Sequence
4771 bases(100 bases per row)
GCATATCGTAAATGGGCTCGCCGCTGTTTTAGTAGCTCACATCGGGTGCGCGCAAACACATCCAGATTTTTGGCGACCAGGCAGCGCCACACCTTAGTGT
TTAAATTCTACCAATCAACGCAAAGCGCGTAACGTGGGCAAATTGTTGCTATTGGTTCATCTTGCTACTTTCTTCAAGAAAGTCTCTTGTCACGTGCGCC
AGAAAAGATTCAGGGAGATGTGCTGGGACACGCGATGGGATCTACCCCGGCTTTGGGCGAATTCTGTCGTGCCTTTGCATCGTTGACcgtaaatttaaaa
atttgtCGGTTACCCGGCGAGATTGAGCGGTGTATTGATATCATGAGGGTTGACTCATGGTCGAGTTTGAGCAGTTGGGTGATGCTATCTTAAGTGACTA
GCTACAAGGTAATTAATTACTTTTCTTTGCTAACTGCCGTCTCAGTTTGACACGTGTCTCAAGAGAAAAGCCAGATAGAGAAATGGCCACCTATTGATCA
CACAATCGGCGTTGCGATTGGAGTTTAAATAAAGATTGAATCGCTGCTGCACCCCTAACCTCTCCGGCTGCCCCTTCTTTCCCGTCTGTGCATAGCCAGA
AGCAGATGCGAGGGGGGAGGCTGCTCCAAGGGTGAGTGGTCGTCCTGCGCTTATTACCATTCCTACCAGGCCGTTGGTACTCCACTCGCCTCGCTCGTCT
TCGTCTCTGCGGTGCCTGTCTCCTTATctaaaagtattttttttgccGGAGCACATCAGTTAGTTTTATGGCCTCCACGTCCACATCTTCGGCGTCCCAG
TCCCCATCCACTCGCAATACTATCATGCAGCCGCAAGATTCGAGCGCCGCTGcactcgatgcctcggatgcTTTCAATTATGATCCGGCTTCTTACCAAC
GGTATGCGCAAGAGCGCGCGATGCATGAGTTAAATGTTCACAAATCACTAGTCGTTAATGGCTCAGCTAATTCCAGCAATGGTCATAAGGATCACACAAT
TGCTACTGACATGCAGACCAAGACCGAGCAATCGTCCGTTAATACTTCCCCGACTAGTGTCACTAAGATGCAGTCTCAAGCTTCTACATCCGCTGCCTCA
ATCTCTAACACGATTCTTAAAAACTCCTCTGTTACGGCTCGAAATGATTCACTTAAATCCAATCGACTCTGCACCATGCCTGGTTGTACAAAGCGTGTGC
GCTCTAAGGGTCTTTGTAAGGCTCACGGGGGCGGTCGACGTTGCATGGTGGATGGTTGCGAGCGCAGCAGTCAGGGCCAGGGCCTTTGCATTCGTCACGG
CGGTGGTAAGCGCTGCACCCAGCCTGGTTGTACAAAAGCATCTCAATCGAACGGTCTGTGCAAGGCTCACGGTGGCGGCTTGCGCTGTCAGAGCTCTGGA
TGTACCAAGAGTAGTCAAGGTGGTGGCTTTTGTCGTGCACACGGCGGTGGTCAACGATGTGAGAAAGAAGGCTGCAACAAAGGCGCACAGCGTGGCGGTT
TTTGCGCTGGTCACGGCGGTAGTCGATTCTGCCAGCATCCTGACTGCACTAAAAACGATCGTGGTGGAGGCTTTTGTGCTGAGCATGGCGGTGGGAAACG
CTGCGATCATCCAGGATGCAACAAGCCTGCGCGCAAGAAAGGCAAATGCTCTTACCATGCCAATGCCGCTAAGGGCAAGCTGCCCAAAGATCAGCTTGCT
ACGGCTGTGTCCTTGCCGCAGCACATGATGGATATGCGACAGATTACAACGCCGACGTTTGCAATGGGTGTGAAAGATTTGCGGGATTCACATGGTCAAG
TCGACCCGCAGCGCGCTGCATACTTGCACCAGCAGCGCGTTGAAATGGACATGCGCTATAAAGGCTACGATGCATCGAGCAACGCTGGCCAGTACCTGCA
GATTCACGCGGACCAGCGATCATATGAGCCTATCAGTCTCCAGGCTAACAACTCCACTCGTTATCATGTGTCTGTGGACAACAGTGCCCTTCCTTCCGTG
TCTGGTGGTATGTACAAATCTGCTGGTGCTATGGACCGTCAAGCTTATGTATCGCGCGCTGCTCCTGATCATATAAAAAATTCATATTCGCAACATTGGA
CCTCAAAGTCAGAGTTACCACAGCATCATTCGGACGGAAGGGTTGACTACTTTGATGTCAGCAAggagcagcaacaacaacatcACTCGCAACAGTCTAG
CCACCACTTGCCGTACCCCTCACAATCGTCGCAGTACCACCACCACCTTAGCCCAGCAGACTCAGCCGCAGCAGCTGCAGCATACAGTCAGCAGCAGGCT
ACTCGTGGGTACTATAGTCAGCACCCGCCGCATTCATCTGCATCCGGTGAACAGTCGACGTCTCAACAGCAAACAAATATGATGTATTACACTGCGAACG
GATATCAACCCCACCAAATCCATAGCATtcagcaacaacagcagcagcaaatgcAAATGTTATGAAGCCCAGCATAAGGTGGCTGTACGTCGTGCTCAAT
TCGACGAAGGTAAAACTGAGTGCTAGCAACTCGGTGACTTGACTGCACTGTTGTAATAGAGATAGAAACGTCTAGCTATGGATCGGCAGCGAATTGTGTT
GATTGCTGTTGGTTTCGGCACAAAGCCTTCCTTCCATTTAAGTTTAAATCTAGTCTAAAAAGTCAACAATCAGATACGTTGTTTCATCGAAACTCTAAAC
CTGCGAACGTTACTTGACGCGCCTCAGCCCATGTACAGCGGCACCACCAACATCTTGATTTCTTCAATGTGCAAAAGATGGCAAGTAACTTCACCTTCCC
CTTCTCTTGCTTGAATAAGTCCCGACTTTTTCGGTGTAGGGCAAAGGGCTTCCACGGGACAGGTGCAGCGCAACTTACATGTAACAGTCAAGACAGCTAA
GCTACATTTTTTTTACACATCCTGGTTAGAAATTCGGGTGGAACACAGTCTACGAGCTGCTTCGACCTAAGCGTCGGTGCTGAAGCATTTCGGTCTCGTC
GATCTCAAAGTTAGAACCTCTTTCGTGCTGTTGCCTGGCAGAGAGACTGTTAGATCGCCGTCGATGTACAACGACCACAGCACGTCTCCAATTCGGACTC
TCGACAGCAGTCGGGCCACGTATATCCTCCAATTTGGCATTACGGGCCGCACCGCTTCGTCTTGACTGCAATTTGGCCCGCAGATAGGCTCCCATGGCCG
ATGTGGGCAGATGTAGCGGTTTAAACGATGAAATGTGCGAAGAGTTGGTGGCATCCTGGTTGTTGGCGAGAGCCACGCGAAAACTGTCTTTGCCGGTGTA
ATAGTGACGATAACATTCGACAAGTTCATGCTCCATGCCCGCATATAATTCAAGCAGCCGCGCGGCTGTTAAATTGTTTTCCGGTTCGTAAACGCGTATC
AGACGCTCCAACTCTGTGCGGTACTTGTCGGCGTACCTCTGCTTGCCTGAGCTTTGTCCTTGGCTCATACTATTTTTGCGTAAGGATTTTTCGAAGAAAC
CTTAGTGGACGCCTCTAAGAAGCCATTATTGGTGAATTGTACTTTTTCGAAACGTTTTTTTCATCTGAACTGAACTAAAGATTATGCTCTGatgcagctc
aaagctcCACGATGCCAATTATTATTACTTTTCCGCTGCGTCTGCATGTAATGTGCAACTCGACTCAGTTTGTATCTTGTGGTAAAGTGTTTGGAAACAA
TTGATCAACGTGGCAATGCCGGTTCGCAAGCCATCGTCTTGCGTTGGAGAAAGTGACTGTGTCGCATGAGCAAAGTCAATGAGACGAATATCGGCCCCAA
AGGTTTCTGCCACAGCGTTTGGGTCTTGGATTGACCTTTCCCCGTCGTATAAAAAGAGGAAGGAGCTAGCGATAAATCGTGTCCCTCGCTGCTTTTCGAA
CCAATCTCTAAGTTGGTCTAGGCGACGCAAGAACTAAAACATGCCGCAAATCAATAAAAGCTTGTATCACAAATTCGTAAGCAGACACTCCTCAAAACTT
ACTGCCTCCAGAAGCACAATTGTCTTCGCAATGTCATTCGCTGGAAAATAGCGTTGAAaggcttgagcaagatggtccACATCAGCGATGTTGCGGCCAA
AATACTTATCATATACATTGTAGTTCATTTTTGCTCGATCAAATACCTTGATGCCTTGGATGCGAAGTCCTACTATCTCCTGCAACGGAAACTTCGATTT
CTCGTGTGCAATTTTTTCAGCTGATGCGTCATCCTCGTAAGATTGAGTGCCCATCTTGACATCCATGATACACGGCCACTTTCTGTCCCAAGTAAGATCT
TCTAGCATCAAGTACTCTGGTACAAATCAAAAACATAACTCGTTATTTTTCGCATTCAACTTGAGAAAACTTACTTACGTCCGGGATGCAATTCACTGCC
CTCCTCGCCATTCGCGACCTCCGGAACTATAATTGTTCCGTAATATTTCGGCAAAAATTTTTGTAATTCTGCAAGTTCGAGCGAACCAGACTCTAAGAAA
AATACGCGTTCATAAAACGTGCACTCGTTCATGCCTCGCCCTTTGCTTTGAAAAGGCTTCAAGATGCGTCCGTTATTAGCCTTCAGACCTGGCAAGCGCA
GCGGAAAGACAACAATAAGCGCACATATTAGCCGTACCAACAGTGTTACACGGACAAGCATAATTTACTCGTTTTGGAAGTGGCATGGCCACCCACTTGG
TGTGCCATCTTAGTGAACCCCTGCAGATTCGCCATCATCAGTATTTAGAATATCTGGGATAATCTTCAATT