Description :
From Genome Similarity Track
Location :
Scaffold_70:45362- 50258
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_70-snap-gene-0.33Carbohydrate-binding protein
Pytve_DAOMBR484maker-pve_contig_70-snap-gene-0.48Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_70-fgenesh-gene-0.20Conserved gene of unknown function

Sequence
4896 bases(100 bases per row)
CGTCCAAGTACTACCTCGGCGTGGCGCTGCTTGCGGTCGTCGTGATCTTCGCGGTGTTCTTCGGCGTCCTCGTGGTCGCCAACAACACGGAGGAGCTGCG
CGACGTCGGCACGTACGAGCACGACCAGCGTCCGTTCAGCTCCAAGTACAGCGCGTACTACGACGAGTACAACTTTGACAACCGGTTCTTCTTCGTGCCG
CGCATCCTGTTGGCCGTGAGCACTGGCGCTGTTGTCGGCATCGTGACGAACGCGACGGCCCAGCTGCTGTGCATTCTCGGCATCACGCTGCTGTACCTGA
TCTTGCTGCTCGTGCGCGAGCCCAACCTGCTGCGCTTCCTGTACTACATCGGCATCACGTCCGTCTTCATGAAGGTGGTTCTCGTGTGCATGATGCTCGT
CGTGGCTCGTGACGATTACTTCCCGCAGACGGTCCGAGACAACGTGGCGTACGGCATCATCGGTGTCAACATGTTTATCTTCCTGCTGCTCTTCATCCGG
CAAGCGTACACGGTGATCCACAAGATGGTGGTCGCTTGCCGCCACAAGAAGAACGGCGATGGCGACGACTCGAACGCCGACACGGACATCAACCTGGAAG
TCGGCAATCGCTCTGGTGCTCCCGGCATGAACCGCGGGTACTCGCGCATGGAGTCGTCGACCGCGTACAACCAACAGCCGTTTGGCAACCAGCAGCACTC
GCTGCAGCCGCAGTCGCAGGCGTACGACTACAACTACCAGCAGAAGCTGCAGCAAGGCGACATCCCGATGCTCGAGCTCTCGGCCAACTCGAACACCAAC
ACGAGCAACTACAACAGCAGCAACTACCCAGGCAGCAATAACTACGGCAACCAAGGAGGGTATGCGGCAGCACCGACTGATAACTATGGTCAGCCACTGG
CCAACAACTATGGTCACGACAACTATGGTCAAGCACCAACAAACAACTACGCACCGCCCTCGAGAAACCAGCAGTACAACCTGGATAGCAGTCAAGGACC
GTCGGCGCGGACAAGCGCGGGGTACGGTGCGTACGGCAACCAGCCAGCCCAACCCCGTGCGGACGACTACGCGAGCTACACCGCCGCTCCAGCACCAGCT
CCCAAGCCGGCACCGACCTACGACGTTCTCGCGGCGTACTTGGGCACGACCAATACGGAGGAGGAAGATTCGTACACGACGTCGCCCCGCGCTTCATCGA
ACGCCGCGGCGGCGGTGCCTGGTACTCGAATGAGCCGGCTGAGTCGAGTGTCGGCACGGCCAGCTGACGACCGCGTCTCGGCCTTCCGCGACAGCTCAGT
GTACGGGACGAGTTTCTCCGGCGATGACTCGTTCGTCAGCGCCAAATCCACCGAGCCAGCGCCGCTGCAGCGCAATCTACGCACCGGCAGCGTTGACGTT
GACGACGTGGACGACGAGGATGATGTCTTTTTGGAGCCTCCAAACCCCGGTGCCACGCATCTGACTGGCGGATCAGACGCAACAGGACCTCCGCGAAGTA
GCCAGTCGTACATCGCCTTCACGGACTCATCTGTTGGAAGCTCGAGCTTCACTGATTCGTCTCGCAGCGCTGGTGTGGACTCGTCGACTGCGTCGAGCAC
GATGAATCACGACCAGCAGCAGCTCTCGATCTTTTCAGACGGCGGCAACAGTTTTGGTGCTGACAACTCGGACTGGTTCATGCGTCGCTCCAAGACGGAG
ATCGAAGAGGAAGTCGACTCGAGTCGCGAGAGCTACGACGTTGACGGCGATCAGGAAAGCAACTACCGGGGATCTGACCAGCAGGGAGTCCGAGCCACCG
ACACGGCCTCGGCGTATCTCGGCCAAGGCGCCACCCGCCACGGCGAGAACGATATCGGGGATGACGACGACTACGACTCGGATAGCGGGAGCGACGCGAT
CCTCGATGCGCCTCGCAGCACGAACGATTCGTTCGTGAGCGCGCGGTCGTCTGACGACATCAACTATTACTTCGCGGGCGACCGATCGACGCAGGTGCCG
CCGCCGAAGCAGACCACAGACGGCGAGCAGTCCAAGAAGCTGTGAGCAGCCGTAGACCACTGACATGTTTCCGCAGTTTTGATCTCTTTTTCTTTTTCGT
TTGAGCGCCAGCTTCGCCTCACGGGGTGTTGTGGGTGAAGTCTGAATAATTATAATGGAGCTGGAGCAGTGCTGCATCGATGGTGGTGCGCGGAGTTGTC
AGTCCAGAAAGCGGCCAGACGCCAGCTCGAGCAGCGAGGAAGCGACGTGCACCACTTCGAGTTTGCACCGCTTGCCGTCCACGGCCGGACACATGGTCAA
CGCTCCCCACAGACCCTCGAGGCCACTGCTCAACCGTGCCAAAGCATTAACAGTATTCGTCAGTTGACGAGTCCAACAGGAGAGACACAGAGACGTCAAG
CGTGCTTTGCCTTTTCCGCACTCGCAGGATGGCCATGCTTGGTTCGCTCGAAGATGCCGGGTTCTCGACGGCGAGCACGTCGAACTCGCTTGCCGACGCG
CCGATGACGCCGAAGACCGTCTTGAGCGTGCTGTCGACCGCGAACTTGAAGAGCTTGGCGTCGTTCGCGCTCGCAGACCCGTCCTCGGTGAAGCTGGAGC
GAGTTGTGTGAGGTTAGAGACTGAGTGATTGGCGCAGCAGCGACCTCGTTGCCTCGCACAGAAGCGACACGACCGCCAGGTGAGAAAAGAGGCAGGGCAC
AATGCATCCACGTACATGGCGACCTTGAGGAAGGCGTGCTCGCTACGCAGCGTGAACTTGTGGTGCGCGGGCATGGGCATGGCAGTGTCCGCCATTGCTG
TCAAGATTGGCAGACATCTCTTGGAAGCAAGGCAATCGTCTCTTGTATAGGGATCATACGGTAGTGCTCTTGTACTGAGTGATTTGAGTTTTGAGATGCA
TCTTGCGCTTTGACGAGCATGGTGGTGCTGCACCATGACGAGCTGCACCGCACGCTCTGGGGAGCGGCGTCGATCGCAGGCCGATCGAAAGCAACGGATG
CGGCGGTCTACGTGCAGTTGGTGCGTCCAGCGCCGTCGTGAGCTTTGCGGGTGTCTCGCCTGGTCTAACATTCATGGTGAAATCGTATCCAGATTTTGCT
TGTTCTGGCGTTTGGAACCTGTGCTGTGGCGTACGACAAGCCCACTGCCGTGCGGCTCGCGGTCGCCAGCGTGACGACTCTGCTGTATTTCCGCAACACG
GCGCTGGTACATGGGAGTCTGATTGATTGGACTCGCGGAGTGGTGGCGCGAGCTGATTTCAGGAACTTGATGTGGATCGGCAGTTCGCTCGCCTCACGCT
ATTCGTGTCGTGCGTCGTGGCGTACGGCGACGTTGTGCGGCCGATCATGGTGCTGATTCATGCAGAGGAAGCAGACGCGGTGACGACCGTCCGGCTCGGA
CTCCACTTTCTGTGGATCTCGAACAATGTACTGCAACTTGGACATTGTGTGACGTTCCTGCGAGTCTGACATGAGCGATGTGCAGATCCGGATCCTGTAT
GCGTTGTTTGCCTCGGGAGCGTTGCGGACACGCACGGCCAAGGCTCCGCGCTCATTCGTGCGGAGGAAGTTTGCGAAAACCGAGTGATGGGGACACCAGC
AACACCGACAAGGAGTTCCCCGAATGGAATACATTACTTGAATATGCAGCCAGCCAACACCGACAACGAGAACCAACAACTCCTGTCTTCCTCATCCGGC
TGCACGCTGACTGCCTGCTCAACTGCCGAGGATCAAGAGCAGGATCAAAATCACCAGCAGCACCAGAATAATCACATAGAGATTGGTGTTGTTGCTCTGT
TTCGCGACCTGGCTCGCACACAATCAATGCGTCAGAAGGACAACCACTTTCTCAACGACCTAGAAGCATAGACATACCTGCGCGGCACGAGTGCCCTCGG
ATGTCAGCCCATCCGTCGCCCGCGAAACGTCGTCGTCGATCTCGTTCAGCAGGCGCACGTGCAGCTCCGTCTCGTCCTTCATCGTCAAGCTGTAGGTCTT
CAAGTTGCTCACGCCCTTGCCGATCAGATCCAGCTGCTGATCCTGGTCTGTACCAGCGCCGATCAGCATCAAGCGACACACAACCATCGCTATATCCGTC
CGATACCTTTCATGATCTGGTTCTGCATGCTGAGCAGCTTTTTGGAGTGTTCGCCCGTGATTTGGCTGAAGAAATATTGCACATGTCAATCGGAGTCGGA
CATTCTCGACCTCAGCAAAGCTGACAGTAGACCAACCCATTGGTCGATGAGGTCCGTCTATTGTATGCGTCCAGGTCCGTTTGCTAACATCACGACGCAG
TGCAGTTATCGTCAGCACTGCATTACCGCGACACCAAAGCGGACTCCACACACCTGATCTTGCACCAACTCGGTCAACAACCTTTCGCGCCGCTCCATCT
CCTGCTTCGTCCTGCACATCCATAATCACGGTAGCGTTAGCACACAAATACCAAATCAAAACATGGTGTCCCGAGAATTTAATGCTCGCAACGCACACAG
AGGAAGCGGACGAGCGCTTGAGCTGGTCAAAGTCGCGCCGCAGCCGCGACACTCCCTGCTGCAGCGCGAACACGCTCGTGCCGATGGCGGCCACATTTCC
CGAGCGGATCTTGTTTGCCAGCGCCTTCTCCTGGCTGCGCGCTCCCTCCAGCCGGTCCAGCCAGCCAGCCCACGCCGTCGCGCTCATGGTCCCGCGCTTG
ACCCGACCGCTTCCTTCCTCGACCGCCCGCTTCGATATCTTCTGTTTCGCTTTTTTCATCGGAAACACAGCCTATCCCGCACGTTCCGAACTCAGATTGA
TGTCGTCCCTTTTCATTTTCCAAGTAAAAACGGGATTGTGTCCCAAACAACGACATTAAATGAGGGACGGATACCCGACCCACTCGTTTCGGAAGT