Description :
From Genome Similarity Track
Location :
contig_38:45362- 58544
Transcript NameFunction/comments
g8685.t1XP_009515581.1 hypothetical protein PHYSODRAFT_293883 [Phytophthora sojae
g8686.t1XP_009515579.1 hypothetical protein PHYSODRAFT_537011 [Phytophthora sojae
g8687.t1XP_009515578.1 hypothetical protein PHYSODRAFT_353509 [Phytophthora sojae
g8688.t1OWZ24221.1 hypothetical protein PHMEG_000753 [Phytophthora megakarya
g8689.t1RAW38034.1 hypothetical protein PC110_g5732 [Phytophthora cactorum

Sequence
13182 bases(100 bases per row)
CATCAAGTTTCCCCTTCGAGAACGCTGCTATCTCAGTGTTGCTCATTGCCCTCCAAGCACCATTGTGATGCGCTCCGGACGTCGCTTCGTGCCGGTGCGG
AAGTGAAGATGCTCTGCCGCATTTACCCGTGTGTACACACTGTGGTAACGATGTTGCCGAGGACACGAGGCCTTCGGTCTGTGCTGTATATAGTCTGCTT
TGCACCTACAAATGTTTCCAATATAGGTAACGAAAGAGCTCTTCATATAAATGAATGCTGAAAAGAGTCGATACATGTAGTCATAGAGAATCTGTGTCCA
GGCGAGCTGAAGCAGAGATTCGTCAACTGTCTCCGAGTAGATGAGCCGATTAGAATGTATTTTCGCCCCAGCGAGCTCACGTTTGAGCCCAGTTACAGCT
CGCAACGGCGAGCATTTGTCAAAATCTAGGGTGATCAACCCCACCTTCAGCAATTCAGCTCGGACTTACTGTAGAAAGGGTTTTCACCACTCGCAGTGAT
CCATTTACTGCAGCATCTTTGCCGACATTGCTCAAAACGTGTTGGATCCAGGTCAGTCTATGGATAGACCCAACCAGCTCGGGGCTCTGCAAGCGTGAGT
CAGGCGGCCACGCCTTGCGCCAGCGATGTGAAGCAACTGGTTTCTAACGATGGATGTTTGGCTGACGGTCGATCAGCACAAACTTGGTCACCAAACCGAG
GCGATCACGTAGTCAACGCGTGCATTCATGCAGGACTATTCCAGTGATGCGTCTGCAAAGGCAAGGACGAAGGCGTGACTCCGTTGTCGTCGGCAGCTTG
ATGCTGCACGTGTGCCGGCACCGGACCGCAACCTGAAAACGACGCATCCCTCCGCGCCACAAACTGCACATTTTCACCACCGACCAGGGAGGATGGGCAC
TTCAAGTTGCGCAAACTACCGAAACTTGTGTGCACCACTCCACTCCAGTAATCAGGTCAAAGCTCGTCGACGTCATTCGCTCAACTTCCTCGCTACGACC
GAAGCCTCCCTCCGCCATGTTGACCCGATTCCCCCAGCGCTTGCGTCTACGTCTGCAATCGACAGACGCCTCGCGCGCACTGAGTTCGGCCGCTTCCTCG
TCCTCTTCGTTGAAAGTTCTGATCATCGACGGATATTCGCCCGATGGCCGCGCAGACCTGGAGGCTGGTGGCGCCAGCACGGCCGGCAAGCTGTACGTCA
ATCTGTTGAACAAGTCGGCGCCTGCTGGAATGAAAGTCGCGTCGGATATCGTGTACCCAGCAGACAGCGATTTCAAAACGCCCGAACTATCCAAGGTGAG
CTGACCGCTTGAATCTTCATCATTTCGTTGAGATTGTGGCAAGAAAAACTGGCCAAATTGTGGAATGCTCAGAGGGTTATTGAGCGAAGAATTGATTAAA
CGTTGCGTGTTCGTTGACAGTACCATGCAGTGGCGTGGACAGGATGCTCGCTGACAATTCATGATACCAAGGACGTCCGTGTTACCAAGCAGATCGACTT
CGCCCAGAAGATCTTCGAGAAAGGTGAGGGTTCAATGGACGCAGTGGAGGGGTCTTTATCATGATTAAAACAAGGCACTAATGTAGAGTTACATGCTGTT
ACTAGGCATCCCGCAGTACGGTAGCTGCTGGGCGGCGCAGATCGCGGTGGCTGCTGCCGGAGGTTACTGCGGGCCGAACCCGCGTGGTCGTGAGATGGGC
CTTGCTCGTAAGATTGCACTGTCCCCCGAGGGTCGTGCACACCCGATGTTCGAGGGCAAACCGTCGGTTTTTGATGCATTCACTAGTCACAACGACGAGG
TGACCCACATGCCTCCCGGCGGACTTGCGCTGGGTGGCAACGACTTCACGGCGGTACAGGCCGTGGCTGTGCGTCACAAGCAAGGAGAATTCTGGGGCAT
TCAGTACCATGCTGAATATGATTTGCACGAGCTCGCAAGGCTCACGTACTGCCGCAGAGAGAAGCTTGTGGGTCTGGGTTTCTTTTCCGACATGAAGAGC
GCTGACCAATATGTGGACGACCTTGAGAATCTGCACATCGATCCGTCTCGTTTCGACATTGCGTGGCGCCTTGGAATAGATGCCGACGTCATGGACGAAA
ACATCCGCCACTGTGAGACGCGCAACTTCATCAAGTACCTTGCGCTTCCCTACAAGGCGGTTGTCGAGGGTAAATAGGCACCGTTAAACCGCATTATTGC
ATTGTATCGCGATACAAGGAGGTAATAGATGGTCAAGTGCTCACAACTTTAATCGTCGATGGAGATTATTGATAACCAGTCGCTTTCAAAAGTTCTCAAA
TCGCTTTGTATTAGCTCGCATTGGCAACAAGAGAGGATATAACCCCTCATTCCGGCTGCTTATGTAGAAATTTGCTGGGTGCATGCGTTGCCTTGGTTCT
GGCAATAGCTTTCAGAGCTTTGTAGTGAGATACTAAAGGCGCAATCTTCACATCAGGATGCTACAAGCTTAGTGTCGTCGATATTGTGGCGATTACTTCG
AAGTACTTTTAAGTGCACTACACTATAGTACTGCATGTACATGTAGTAGGAAGTAAAGACCCGGTGCCACAATAAAACTGCTACTGGTACGAATCTTGAA
CGTCCAGCGCATTTGAGCTTTAATTCGTAAGTCCGCCTGCCACCGCTCAGCGCTCCAAGTCGTATGCGCCGAGTGTCAGCTCTCAAGATTCATTGCGTGA
GTTGCAGTGAAGTCTCAAAAGCTTTTGCTGTTTTCTTTCGCTCTTTGCAACAACTTCGCAAGCACCGGTACTCCATGCAGTAGTTTTCAGTTTCGTAAAT
GACAAGCTAAGAAATCATTGTTCAGTGGTTAACACGTTGAACGAAAATGCACGTGGATAAATGCAAAATGCAGAAAAGCTAACTTGCTACCCACAGAAAC
CACAGAGAGACGAGACGAACGTCAAGCGCAATCAAAACGTGTTGTAAAGACGTCGAGATCTCGCCTGGCCCCGTTATCTACAGCGTACGCTTACTGCTTG
CCGCTTTTCTTCTTGGCAGCCTTCTGCATCTTGACGGCCTGCACATTCACCTTGACATCGCGGGTGAAGGGCAGGTAGGTGACGCCGCCCATGAAGGGGA
CCAGCACCTCCGGGACCTTGACACCGTTCTCGTCCTGGCAGTTCTCTAGAATGCAGCACACTGTACGCGTGGAAGCGCACAACGTCGAGTTCAGCATGTG
CACATACTTCTTCTCGCGCTGGTTCTCCTTCTTGACGCCGCAACGAATCTCCATGGCACGCGCCTGGAAGTCCGTGCAGTTCGAGGCCGACACCAGCTCA
CGGTACTCCTTGTAGGCAGGGAACCACGCCTCCAGGTCGTACTTCTTGACAGCAGCGTTGTTAAGCTCGCCCGACACGATGTTCACCACGCGGTACGGCA
GGTTCAGCGACTGGTAGAACTCCTCGGCATGACGCAGCATCTCGTCGTGCATGGCAGCAGAGCTCTCCGGGTCCGTGATGCAGAACTGCTCCATCTTGTC
GAACTGATGCACACGGAAGATACCCCACGTATCCTTGCCGTGCGATCCAGCCTCTTTACGGAAGCAGGTGGAGAAGCCACCGTAGCGCAGAGGCAGCGAG
CTCTCGGTGATCCACTCGCCCTTGTGATAGCCGCAGATGGGCTGCTCGGACGTGGCAATCAGGTACTTCTCGTCCTCCCCGATGACCTTGTACAGCTGCT
CGTCAAAGTCGTCGAGCTGCGCGACAGCGGCCATGCACTCCTTGTTCATGAAGAAAGGTGGCTTGAGCATCTTGTACTGGGCCTTCATAAGGAAGGCCGT
GGCGTAGGCCATGAGCGCCTGCTCCAGCAGGAAGCCGTAGCCCGTGAGGAAATAGGCGCGGTGTCCAGCCACCTGCACGCCGCGTTCGGGCTCGTAGCCA
TCGATGCGATGCAGCACCTCGTGGTGGAAGTGCAGGCCGTCCTTCTGGATGGGGGATCCCCACTTCTTGACCACCACGTTCTCATCCTCGTTGCTCGAGA
CGGGCACAGTGGGGTCCACCACGTTGCCGATCTTGGGCAGCTCGCGGTCCAGGAGCAACTTGAGCTCGTCAGCCTCCTTCCTCTTCTCGGGCAGCTGGGC
AGCCAGATCCTTGCGCTCGTCGCTGAGGGGCTTGAAGTCCTGCTTGGCCTTGCTGAGCTTCTTGATCTCCTGCTGCAGCGCGTTCATCTGCATGCTGATG
GTCTCCACCTCGCCCTGCTTCTTGCGCCACTGCTCGTCCAGCTCGATCACCTTGTTCACGATGTCCACATCTAGGAAGCGCTTCTGCTGGTCGGCGCGCA
CGGCGTCCGGGTCGCCGCCACGCTCGGGACGCAGGCGGTTGATGTCGATAGGCATGTTGGAGTGCTTGGCTGAGGGTGCGTTGCTTTTCCACGTATGAGA
GCGGGGGCCATCGAAGCGAAGATTCGCTCCAGCCACAGGAATAATCCTGGTCGGGCCTGAAAATGTGTAGTCGGTGGCGCATTAAGTAGCAACTAATCAG
AGGCGGATATTCTTATATAACGTTTAAAACTATGAAGTATTATGTTTTTACTTTAAAAAAATATAATAAACGGTGAGAAAGTCGAAAGCGTGCGTTGTGA
GGGACAAACTAATTTCCAGCACCTGGCACTGTCGTCGTCGCCACCCGACGAACCTGCGCCATCCTCGGAGACATTACCGGTTAGACCCTGCTTACCTAGT
CTTCGCGGCAGTAGTTTTGCTTTGATGCGTCTATATTGAATATGTGCGGGTTGCTTGCTTTCCCTGCTGAGAGCCCTCGGTTAAAAATATTGTTTTGTCG
TAGCAAGAAGCAACCTGGATTCATAAAACCACTTCAAAGTTTCATCATTGCTTGCATATCGGCTGTTGCTACGGAGATCGTCATAGCAGCGTGCCTCGTT
GGTGGTGGCGCTCCTGCGTGGCGGCGAAACGATCCACAACTGTGTTGGCGTTCGTGGCGCCTTTCGTTAGTGTGGCCAGGTACGAAACCAACAGAGCGTC
GTTGTACTCTTGCGTGAACGCCGCGTCGAAATGCTCCGACTTCATGGCGGGCAGCTGATTGCAAATGCTCGAGATGTGGCGCAGCAAGTTGTGGTCTAGC
GGGGCCTCGCCATCTTTCATGGCCTGCAAGAAGCGCAGCAGCACGTCAACCTGACGGTCCAGCATCTTTACAGCGTCTCGGACGTTGCCCAGGTACGGGT
GCACTGAAGCAGCGGCAGCGAACGTTAGGTTAGAATGAATGCCACATCCAAACAAATATCCTGAAGACGATGCACTTACACGACGACTTGCTCGCATCGC
CAATCGGTGCGATCTTGGAAATGTGGTCGATGGCGATACCTTCGGCTTCGGAGGTATCGATTTTGAAAGGCGCCTTGACAAAGATCATCTTGGGCACGCC
GTTCAGCATGTGCAGCTCCGACTCGAATAGCGAGATCGGCAGCTTCTTCTTGGTGCTCGGCCCCTTGGCCTCGGGGTCTAAGATCATGAACAGCGGGCTC
TCATTGAATTCCATCACCTGTACGATAACCAAATACCTGTCAGGCCAACCTTCACCATCTCTACCAACCCACACGCCCTTCTCACCACGCGATGCACCGC
CAGATCACTGGGCAGAGCCTTAGCGCCCACCGTGTACCACCCTAGCAGCTCAAAGCCCGGGAAAACCTGAGAAACTGCAGCACCGCAAAACCCCGCGTCA
GTTGCGCAGTCTCCTTCCTCTTAGCGTCTCCACGTCGTACATTGCTGAATGCGCGAAGTGAGGAACTCCTTGTCGATCTGAATCTCTCCACTGGCGCCCA
CATCAAACTTCATCTCGAACGAGTCGTATACGTCCACGTCCAGCCCCTTCTGGATACCGAAGAGCGCGCCGATGACCTGCGGCGCCTCCGTCTGGCTCAG
CTGCGAGTTGCACTTCTGCCGGGTCTGGTGGTCGGCGATGTTCACGATCACCAGCGGGTGGATCTGGATTTGCCGCTCGCCTCCGCCAGCGCCGCTGTCC
TCGCGCTGCACCAGCATCTCCTCGTCCTTCTCCTCTGCGCTCGCCATCTCCGTGTCCTCGCGCTGCATCTCCTTCTCGTGTTGATGTATGTCGACGATCC
TTGGTGTAACGTGGTGTGTTCACAAATTCGGTGACTTGACTGTTGTTGTGGTGTACGCTATATGGTGGCAACAGTTGGACCGTGCCTCTAAATGATGTAC
GATTTGTGTTCATACGTTTTTGCACTCAATTGCCGACATGACGGCACTGAATAGTCAGTGACTATTCCGGTAACGCCAAGCTCGTTGAACAGGCCCTCAA
GAAACGCAGTGCCGCGCTGAACCAAATCCCCCCTCCGTTGCAGCATCGGAACAACGCAAACCGCCGCCGGGGGCCGCCGCCAACATGAGCGACCAAGTGT
CCGACGACTTCATCTGGTCCTTGGACGTACGCGACGACCCGAGAGGCAGGAAATTGATACATGACTGACATCTTCTGCGTCCGTTATATGTTGCTCAGAG
CCTGATAAAGAAGGATGCGGGCGCCGACGTGGAGGGCGACGCGGACCTCGTGCGCGCAAGCTTGTACACGCAGGACAACCTGCTGGGCTCCATGATCGGC
AGTGACCTGGTATTCGGGCGTCGAGAATCCGCCAAGTTTGCGCAGGATGAGGACGTCGCAATGGGAGGCTTCGGACGGCCCACGGGCCTCATGGGCTACG
GTATCAACGAGGACGAACTGGATGATGACGAGACAATCGGCCCGATTGAGGAGCGCCTCCCAGCCAACTTGAGCGCCACGCAGCCAAGCAGCGGCAGCAG
TTATTACGCCCGACAGTCCTCCAGTCAGCTCAGTGAAGACACAGATAGGTCCTTTTCGTTCGCATCGGAGGATGACCACGGCATGGACCCTCTGTCCCTA
CCTTCACCGCAGAGGAAACGTTCCACGAGACGATTGAGCGACGGAGATCAGGATACCTATGAACAGCGAATCGAGGCGTCCCTGGCTGGGTACATTACCA
AGTCGCTGAACATCGAGTCGCGCATGGCCGCAGAGGAGCAACTGGATCGACCATTTACAATGAGCGACCTTGCTCATTTCAGTCCGCAGTTCGGGCGAGA
GCTGTATCTCGAACGACTAGGGCAGAGTCTGCAGGAGCAAGAAAGTGGAGGAAAATCGCTGGCTTCGTACCGACGAGCCTCCATGCAGCGGATGTCCACA
CCAGCAGATATTATTCGGCAAGGATGGATCATGAAACGCGGAGAAGTGGTCCCTAGTTACCGGAAGCGCTGGTTCACGCTGCGTCGGATGCCGCAGGGAC
CGATGCTAACGTACGCCAAAGACAACAATGAGACCTCTCCAGCTAAAATGATTGATCTTAGCTCAACGTCGCGCTGCGTGACTGTCACCGGCAGGAACGC
AAAGGAGCACGAATTCAAGGTAATGACATCTGCGGATTCCTCGAGGCGTGAATACTGCATGGTGGCAGCTTCCAGCTACGAGATGACGCAGTGGGTGTGC
GCTATTCAAGCTGCCATCAGTGCCGGAAACAGTTCTACGTTTGACGGCGCCACAGACTTCAAACAGCTATGGCACGAAGCTGGAATCCAAGGATTTTTGG
TTCGATACGGTGTGCGCAAGTGTAGCTCGCGGAATCGTCTTCAAACACGAGTCCTCGAGCTTAATTTTGCAGAACAAACCCTTACAAACTCGCGACGAGG
AGAGACCCTCACGACATTTCATTTCACTGATATTCGCGGCATTTCAGTAAGTAGTGTGCGCTCTAGCGGCGAGGAGCATGGTGTCAGTATCGATTTCCAC
GGACGGCATCGATCCTGGCCAATTTTCTTGGATTCGGTGGAGGCTCGAGATGATTTGTTTGGTATTCTGCAGCGTATTGTTGGCAATGTGGTGTCGGGCG
AGGACCTTGAAAAGCGGTCGTCTCGGTTGACGCTCAAGACTGGTCACCTCGAAACAAAAAATGCTGGGCCCCACGCTACGCTGCGCGGTCGTTTATTTGT
CTGCCTTCACGAAAACTGTATCGTGTTTTATCCGGAAGATGGAGATACCAGTACACGGCCGTGGTATGTCATTGCCCTTAAGGGCCTTCGCGTTTCGGTT
CGAGAAGAAAAGCGAATACTTTATATTGGACGGCTATCGTTAGCGTGCTCGTCCACAGCAGACTGTCGTGCCTGGTATGATGCCATCTTAGCGGCTACGT
GCCTACCAGCAGAAATTATTGAAATCGAGCTAAAGGAGCGAGCGAAGATCCGCACCGTTTTCCAGGTGTGTGTGTCTCGGCTGCGGAAATTGCTCAAGGC
TAAAGTGACGCCCGAATCGAATGGACCACCGAAAGATCAGAAGACGGTGACTTTGTTGATCAGCAAGCTCTGGGAGCTCGTTTTCCCGGGAGAACCTTTC
ACGTCAAATGCCGATCCCAAGTGGTTGGAGATTGGTTTTCAAAGAGGTGGCCCTGCGTCTGATCTTCGTTCAAGCGGTCTTCTTGGACTCTACTGCCTAA
TCTTCTTTGCCAGCTATCCGTCGAGCGAATTTCAACGTATCCTGAAGCGCACACGGCATGGTGTGAGTGAAGGTAACATGAAGAATTACCCTCTGGCGAT
TGCGTGCATCAATGTGGCATCGCTTTTGACCGAAACGCTTGGTTTGGGCGACGCTGGAACGCACTCGGACGGTTGTTCGTTAAACGCGATGAAGACATAC
AGCCTTTTGGTTGCACAGAGTGTCAGTAAGTCGAGGTCTTCAAAACCAGCAAGGGTGTTTTCGACGTCGCGGCCGCTAAGTGCTTACGAATCCTGGGAGG
AAATTGTCGACGAACCGGAGAACCACGTGTTTGAGACCATCTTCAGCCTTCTCTTCCCGGTTCTAGACTCGCTTTTCGTTGAAATGGGAGCGGTAAGTTT
GTACCTCGGTGCGTGAAAGGTGATGTACAAGCTGACGGTGCTGTTTGTTTGCTACAGGGGTACATGGAATTCGGTCAAGTCACCATCGCGTTCCGACAGC
GCGTGAATGAGATTTTCAACGCGCAGCCCAAGTCACTGAAGGAGCTTCAGAAGCTGGCGAGCGAGCCTTGCACGGGCACACTAGCGGTGCCGACGGTGTT
GCAAAGTAAGCATCACAAGATAGGGAAGATTGGCTTGGGCAAGAAAATAGTGAGGGCGGGCGGCGTATAGCTACGACGAATGCAGTCTAGTCTTGCCACC
CCACATAGAGATTTTGAAACAAAGCCAATAGAAATGCCATCCACTTTGCGCGTTGAAGATGCATTGAAATGAGTTCCCGACAACTTACAGTATAGCATAA
ACTTCACGTGACCACAGTCGTGGGTCAGGACGCTCCACCCCACACTCCGATAGATGCGGCGCTGCCACCAACGCTATTTGCTCGCGGTAGCTGAACTGGT
GGAGGAGTACGATGCAGATGCAAATGCCGACCCCTTCCGCCACCACGAGCACCACCTCCTGATCCACTGCCCCGTCCATAGTGGTGGTGGCGAGGTGGCT
GATGGTGCCCAGATCCTCCATGATTCACGGCCGAGCGGGCCAAGAAGCGTTCCCACGACAGCTTCATCTCACGCAGAAGCTGTACTGATTGCTCTTTTGC
ACGGCCCAAAGCCTACACAAGAATTTCAACATGTCTGATTAGAAATTCTCGAGACCTCTCAAAAACGAGAATCCTTACCGATTCCGATGTGCTGGTAATC
TGAATGTAAGCTTCTGGCATCGTATGCGAAGAAATCTCCTTTTTGCCGTCACCCCGACCTTTGCTCCACTTGGCTAGCGACTGTGGCCACGGTCCAAAGT
AACGCAACTGGGCACATGCAATAGCTTCGATCTTTTTCAGGTGGATGCCGCGCTCGCCGAGCAACTTTCCCGGGAAGTTAAACCGCCGTGACACGAGCGC
CTCCGCGTCGACAATGTCATACACATTCACGCGTGCAAAGAGGTGGCCAGAGGAAACAGACTCCTCGCCATCACCACTCAGCACAGCGTGCTTAAAGCTG
CTGCTTCCGCTGCTTTCGCTATCATCTTGACCCATTTCATCTTGTTCCAGGGCTGAGAGTCCAAGCTTCTTCATTTGCCGTCCTCTTTCTTCTAGCACTT
TGCCTTCCTCTTCCTTTCCTTGAAGCCGTAGGCATTTTCCGATTTGTTCTAGTTTCCACGAAGTAAAAGCGTCAATTAATATGACGACAAGTGCATGCTG
GCTCACGAATTCGTACCAATACAAAAACCAACGTCACGTGTATCTGGGAAAAGTTGCTGACGAATGTCTTGTGCTTTTTTGTAGGCAGCAATAGCTTCAC
CATAGCGTTTCTATCAACAATCGCATGTCAATAATCAAACAAAACTGTCGGCTTAATCCACTGCCATACCTGATCCCGATACACACGCGCGAGATTAATA
GAGATTCGTGCTGCACGGGGGCTGATGTCATTGAAGTATCGATCCGTGATCTGCAGGGCTTCCTTAATGTTTTCTTCTGCTCCACGCCAATCTTTCTGTT
TCCGAGAGAAAAGTTGTAAGAAAGCGGCCACATGCAGAATAATCGAGTTGGTAAACGAGACATACCGCTAGCCGCTTGAAATTGCCCATGTTGTTCAGTG
TAGCAGCGGTCTCAAAGCTCGCATTTCCGAGTCTGCTCCGGCGAATTCGGAGTGCTCGGTTGTACAGACGACCAATTTCTGCTCGCTGTGCTGCTAGCTC
CACCTCGCTGACAACAGCAAACAAGCGTTAGATTGACATGACTGGGGTTTTCGGGGCAATTGATTTGACATACCTCAAGTGCTGGGTTTCAAGTTGGTTC
GAAAGATAGAGCGCCAGGTTGTTCAGCGACTGAGCAACTTGAGGATGATTCTCACCAAGCGTTATCTCTCGTATCTTGAGGGATTGACGATACATGCCAG
CGATGTCGGGCCGTGCCTCTTCCTCCCCAGTTGTAGTACTCTTGTTCACACCCGTGGTGACACTCTCCTGGCTAGGGCTTGTCACACTTTCGCTGCTTGT
ACTAGATCTACTTGGGCTCGGACTAGAGCCAGAACGAGCACCTCGGTGAGCAGTGTCATTTCGCCGCCCACCGCTTTTTCCTCCCCTCATGAGCTTTTCT
CTCGATTCACGAGCATCCTCACGCAGTGCCGCCGACGGTGATCGACGTTTACCGGCGGTTGGATAGTTCTTGTAAAAGTTCGCTAAGTTGTTCAGGCTCG
TAGCGTACTCTGGATGATTTTTACTTAGCACCCGACTACGCATCTCAAGCGCCCCTTTCAGCAAGCGCTCAGCGTGCTGCAGCAACCAAACATTATGTGC
AAGATACCCCCAGCGCGTGCTGAGACAATTGCCAAACTGATTAAGCACTTCAGCCACCTGCGGATGTTCCGACCAGCCCAGTACCTCTCGTTGCAGCCGC
AGCGATTCAAGATAATGGTACTCTCCTGCAACCCAGTCGGTGACATCGCAACAGGCGTAGCCCAAGTCAGTAAGTAGAAGAGCTTCTAGTGCAATGAGCT
CACGTATTCCAACACAAGTACAGCGATCGTGTGCTGCAGCAGCAGCGACGGGAGGCTGTGGTTCCTCGAATGAAGGCAATTTGTCCAGCAGCGACAGCTC
TCGATCATACTTAGCTTCTTCCACATCCCACAACAATGCTGCAGGATCATTTTCACGGTTCCCACATGTACAATGTAGCGAACGTGTCTCCCGTGAGAGC
TGCAAACAGGAAGATACCACTTGAATACGCCGTCGTGGTTCCACACGCGCGCGAAAAATGAAGCGACACCGAACAACTAGATTACTGTACAGAAGCCCGT
CCACAATCGAGGAATTTGTGAGCGCTGCAGCACCTGCAGACCGGCGGCTACTCCCGGTACTGCTGCTTGTACTTGCACCAAAGCTACTGCTGTGGCGCTC
AATGGATGGGTTGGGCGTTAATGCATCATCTGTGTACAATGCTGGCTCACTTTTTGATCTCATAGTACTGGTGGAGTTTACAGGAACTTCACCAAGCTGA
TCACTAACAAGCTCTTGTTGTGTACGACGATTGCTCTCACGCACCTGCTCAATGCTCTGTGACGTGAGCTCATGAGCTAACCGCATCGCCGATTCAATAT
TAGCACGTTCCTTATCGAACAGCGCCAACGTGCCCTCAAAGCGGTAGGCATGTGAAGCCTTAGCCACGATCATGCAGTAATAGCGCACAAAACGTCGCTT
CCAAGTGAGAAGAAGCTCTTTACCCAGCGGAAAGCTCCTAGTTGGTGCGCCCATCGATGCCTCAACAAATGATGAAGGTGCAAAACTTGGGCTTGAAGAG
AGGGGCCCTGCGTCGGGGAAACACTCCTCGCCCATGCGGCCAGCTTCTTCTTCAGCAAAAAGCTGCACTAGATTGTGCATACGGTAACGATTCGTTTTCG
TGTCGAACTCCACTAGCGACCATTGATGAAGAATCTCAAGTGCTACACTTGCCGAGGGTACACTCACTTCACGAGCTTTCACCTCTTCGCAGCTCTCTAG
ATCCAGCAAATCGTAGCTGTCATTCGTCATTGCACCATCATTGTCGAAGCCGAATCCATCCATGTTTGAAGCTGGGATCCAAGACTACGCACGGAGGAAA
CGTCATCGTCACGACTACGACTTCGGTGGCTCTTGGCGTACGCATGAGCAGGGAAGATCGATGAGGTTGAAGCACTTGAAGTACTAGTGTTAATACCCGC
TGAACCACTTAATGACGAAGACATCAAAGAGTAGCCGCTACTCCCTGCCAACTTGCCAGCAGCATTCTGCTCCGTCAAAACACTGGAAAGCACAGCATCT
GCCGCTTCGATCTCGAAGCTACCCCGAAAAAATCCAAACGCCATGAACGCTAAGCGCAGTGGCTCGTCCAGGTGACAGAAAGATGAGCGAATGCAGCGAT
CCACACATTCTTTGTGTCCAACCTGGTTGAGTTCTCTGATTGTTTCGAACCTGTGCTCATCACGCTGGCACACAGAACGAGAAGGGTGTACGTAAGATAA
AATGACAAGTAAGTCACAGCGAACCCATTCAGGCTTACTTACCTCTAAGTACTCGATCATACGCTCAGGTGTGACTGTCATCCGTGCGTTAGCAAGTGCA
CGACCAACAACGCGAATCGCTAGTGGAAGGCACCGCAAATCCTTGCCAGGCGTTCAGCTAGTTTTGTAGAACAACCAGGGGC