Description :
From Genome Similarity Track
Location :
contig_15:453567- 454617
Transcript NameFunction/comments
g3439.t1DEAD/DEAH box RNA helicase, putative

Sequence
1050 bases(100 bases per row)
CAGCTCGGGCCGTGCGACCCACGCGGTGGATGTAGTCCTTGCCGTGCGTGGGGATGTCGTAGTTGATGACCACGTCGACGCTGGGGATGTCCAGGCCGCG
CGAGGCCACGTCCGTGCACACCAGCACGTTCCGCGCCTTGGCCTTGAACTTGTTGAGCGCACCGAGGCGGTTAGGCTGCGTCATCTGGCCGTGCAGGCAG
ATGGCCTGGAAGCCCAGGTTGCGCAGCATGAGCGTCACCTTCTGCGTGCCGTTGCACGTGCTGGCGAAGATGAGCACCGACTGGCCGGCCACCTCGTTGA
GCACGTAGGCCAGGTAGCAGTCCTTGAACTTGGCCGGGATGAAGAGGTAGTGCTGCTTGAGCGTCTCGGGCGTCGCGAACTTGTGCGTGATCTCGACCTT
GGCCGGGTCCTTGAGCGACGCGCGCTGCAGCTTGCGCACCTTGGAGGTCATGGTGGCGCTGAAGAGGTACGTGTTGCGCTCGGCCGGCATGAGCTGCACG
ATCTGGTTGATCTCTTCCTCAAAGTCCATGCTCAGCATGCGGTCGGCCTCGTCCAGCACGAGGAACTTCATGGTGCGCAGGCTGAAGCCCTTAGTGTTCT
CCAGGTGGTCCACGAGGCGGCCGGGCGTGGCGATCACCACGTGGGGCTTGCGGGCCAGCGCTACCTGCTGCTGCATCATGTCGATGCCGCCCACAACGCA
CGCGCATTTCAGACCAATGGACGCGCCCAGCGCCTCGAACTGCTCGCCAATCTGATAGGCCAATTCCCGTGTCGGGGCCAGCACCAGCGCGTACAGTCGC
TGCGGGTTCTGCAGCAGGCTCTGCAGGATCGGGATCACGAAGGCGCCCGTCTTGCCCGAGCCCGTCTCGGCCAGGCCGATGAGGTCCTGTCCTGCCAGGC
CGTGCGGAATGGCCTGCTGCTGGATCTTGCTGGGCGCGGTCCAGCCCACGGCCGCGATCGCCTCGCAGATAGCCGAGTCCACGCCCAGCTCCGCGAAGCT
CTTGGAGCCGCTGAAGCCATCGGCCGCCTCGTTGGTCGCGTCGGCCGGGG