Description :
From Genome Similarity Track
Location :
contig_47:453524- 454853
Transcript NameFunction/comments
g9285.t1hypothetical protein

Sequence
1329 bases(100 bases per row)
GAGGGCATCGAGGACATGACGGCGCTCAACTACCTGCACGAGGCCGCCATTCTGTACAACGTCAAGAAGCGCTTCCTCCAGGAGCTCCCATACACCTACA
CGGGGGACATTTGCATCGCCGTGAACCCTTATCAGTGGCTGCCTGAGCTTTATTCCGAGCAAGTGCAGTCCCAGTACCTCACCAAGGCTCGGAATGAACT
GTCGCCCCACGTGTACGCCACGTCCATGGCGTCGTACAACGACATGAAGCGCCACGAAATGAACCAGTCAATTCTGGTGAGTGGCGAGTCTGGTGCCGGG
AAGACCGAGACGACCAAAATCCTCATGAACCATTTGGCCTCCATCGCGGGAGGCTTGAACGACTACACGATCAAGAAGATTATCGAGGTGAACCCCCTAC
TGGAGTCGTTCGGTAATGCCAAGACGGTGCGCAATGACAACAGCAGTCGATTCGGCAAGTTCACCCAGCTCCAGTTTGATAACGCGGGCATTCTAGTGGG
AGCCCGATGCCGCACGTACTTGCTGGAAAAGACCCGAGTGATTTCCCACGAAGAGATGGAGCGGAACTACCACATTTTCTACCAGCTGCTGTCTGCTAGT
GACAGCCAGGAGCGGTGGTTTCTGGATGACACCAACGAGTGCTATGCGTACACGGGCGCTAACAAAACGATTAAGATCGAAGGCATGTCGGATGACAAGC
ACTTCGAGCGCACTAAAACCGCGCTTGGACTCGTTGGTGTAACGGAGCAACAGCAAGAAGTTCTCTTTGAAGTGCTTGCGGGTGTACTGCACCTTGGACA
AGTGCAAATTCAGTCGAAGAACAATAATGAAGAGTCAGCCATTGTCCCTGGCGATCGAGGGACGAAGCATGCAACTAAGCTCCTCGGTATTTCGGCAGCA
GACCTGGAGAAGGCTCTGTGTTCGCGGCAGATCGCCGTCGCTGGTGATAAGGTGACGGCCTTTTTAAAGAAGGATCGAGCCGAGGAATGCCGTGGTGCGC
TGTCCAAGGCCATTTACTCTAATGTTTTTGACTGGCTCGTCGCAACGATCAATACGTCACTGGAGAACGACAGGAAGATGCGCCATCACGTCGGAATTCT
CGATATCTTTGGCTTCGAGCACTTTAAGCACAATTCCTTCGAGCAGTTTTGCATCAATTACGCCAACGAGAAACTCCAGCAGAAATTCACACAAGATGTC
TTCAAGACCGTCCAACTGGAGTATGAAGCTGAAGGTATCATCTGGAGCCATATCGACTTTGCGGATAACCAAGATGTGATCTCAGTGATCGAAGATCGCC
TCGGTATTATTTCGCTGCTTAACGACGAA