Description :
From Genome Similarity Track
Location :
scaffold_86:45334- 46442
Transcript NameFunction/comments
g3138.t1 hypothetical protein PHYSODRAFT_323421

Sequence
1108 bases(100 bases per row)
GAGTTGTGCTCCAAAATCCACTCGACGGCATTTGGAAAGCCCTCAGCAACGTAGGAGGGAGGAGGATCTAAACCCACCAACCAGCCTCGATTGAGTTACC
ACACTAAAGATAGCCCAACGGAAGCCCCAACGTACCAATTTTCGCTTCATCGCCACTTCTGTATTTACCGGTCCGGACGAGCACGCCATGCATTCCCAAC
ACCATGGCACCGTGTACGTCTTGGCGAACGTCATCCCCAACCATCACCACCTCTGCCGGGCCAACGTTCCTAGAGAACAACAACATTCACGCACCTTGCA
TCAGCACCACAATTGACGGATGCAACAGACAGTTGCGTGCTCACATGTCCGTTAACGCTTGCCCGTAAAATGTTGGTGTGGGTTTTCTGCAAACAGAAGC
GATTTAGTTGTAGTCGTAGTTGTAAAATATGGATCGGCATGTGACTATCGATGTAAAAGAAGATGAAGTTGCAAAGTTCCTACAGTACCCAATGGCAGTC
GCTTGAACGCCTGCTGAAAACTCCAGCGCTTTCACAAATGCTCCGGGGCCGATATTAAGTCCGTCTTTCCCAGCAAAATACCGCGCTTCATGCAGTGCTA
TCAAAGACCCCCCATTTAGCAGCACGCGGAACGCTTCATTAAGCTGTCCGAAAGCAAGTAGTTAGCATCTGCCGCCTGCGCACACGAGGTAACTTTCGTT
GTATATACCTTATCGTAGTGGAAGTGCTCAGGTGCCAAACCAACAACGACAGCGTTCGGGTTGGTGCGGTCAAGTCCGTCGAATTCTTCCTCGAGCGAAG
GATCCACCAGCAGCAACGGACGAAGGTTATGTTGCTCTAGTACGCTACGAGCGATGCCTCCCGATGTCAGTACGTGCTCCTCTTTAATGTTCTTGAGGCC
AATATCGTGCAGATGTTGGATCTGGGATACACTCGACCATTAGTCTGCAAGATTTTTAAGAAATTCTGTACGCGCGAGACGCACCAATTTGCGTCGAGAT
TTGGTCGTCGTGTTGGTCACTGCCGCGAAATCAATGCACGTAAGAACACGGTGGGCGCTATAAATTAGAGGTATACTCAGACACAGAGCTTGACGCACCG
AAGCGCAC