Description :
From Genome Similarity Track
Location :
Scaffold_7:453312- 454525
Sequence
1213 bases(100 bases per row)
CAAGGGTAATACGAGTCACTGATCTGGGTGGATCTGTTCACTGGATACGTAATCGCGAAGGCCAGCGACTCCAGGACGGCGCAGACGATCACGGAATCCT
ACGAAGAGTGTGTATTCAGACGATTTGGTGCCAGCGAGGTGATTCGCCACGACCGTGAACCGGGGTTCATGGCCGACTTCTTTAGATCCTTCAACAAGAT
CCTTGGTCAGCGACAACGTGCGACGATGGCGTACAGGCCGCAAGCAAACGGAACCGCTGAGCGCATGGTGCAAACAGCCACTCGCGCTCTGAAGATGTAC
GTGCAGGATCTGGATCAGCGCGATTGGGACGACTACGGTGAGCGTCTCACCTTCGCACTCATTACCGCCCAGGATCGGATCCGAGGAGAGACACCATTCT
ACTTGGTACACGGCTGGGATCCTAGATCCACGCTCGAGGCTACGATCCCGGTAGGCAGCACTCGCCGTCAGGATCGGGGTCCGCGGCGGTGGCGATACCA
GATCCAACGCCATCATCAGCAGGCACGGGCAGAAGTCAACGCACGACTGCAAGAGGCGATCTCGGATCGGGCGGACCGGCACAATGAAGAGGTCCGTCCG
CACCAGATTGAAGTTGGATCCAGAGTTTGGTTGTATTTGGATCGGGTGAAAGATATGCTCGCAAGTTGGCTCATATGTGGCACGGTCAGTTCCGCGTGGC
GGAGAAGGTGGGAGAATACGCTGTGCGGATCGAGACCCCTGGCACGGAGTACCGGCTGTTCCCCGTGGTGCATGTTTCCAAGTTGAAGCTTGTGAAGAAT
TTCCCAGACCGACCCCAGATCCAGTTGACCGAAGGCACTACAAAACGATACGACTTTGATGAAGCACTACTGCCGGAAGACAGCTGGATCCAGGATCTAG
GTGAAGATGAGTACGAAGTGGAGAAAATTACCGACATGAGGACTGGAAAGCGCACTAGGTACGGCCGGATCCACCGTGAATTCCTGGTACACTGGCGTGG
ATACGAAGATCCATCCTGGGTAGATGAGGCACATCTCAACTGTGGATCTATACTGCACGAGTTCCTGCGAAGTCGCACCAACCGGATCCGGTTCGGTGCG
ATGCAGTCTCACGAAGAGCAGTGAGACCGGAATCCCCCAGAGTGGGTTGGCCACTTTGGGAGAAGAATGTGGTGATGGATCTGCAAGGAGGTTGCAGATC
GATGGATTGGGGA