Description :
From Genome Similarity Track
Location :
contig_24:453305- 454690
Transcript NameFunction/comments
g5444.t1hypothetical protein

Sequence
1385 bases(100 bases per row)
CTGCAGCGTCTCGTTGGCATAGTTGATAAGCAGCTGCTCGAATGAGTTGCGGTTCTTGGGCTCGAAGTCCTCGAAACCAAAGATATCAAGCACACCAATG
TACGGCACCACATCACTGCGGAACGAGTCGTAGTCCAGGGCTGCAGCACACTCCCACATAAGCCACGTGAACGTGTTCTCGTAGATAGTTTGGCAATGGT
GTCACGCGAGTATACCGCGTTACGCACATCGCGCTTGATGAAGTAGATCGAGTTGCGTCGAGATCCACGCGTCATGATGCGCTTGAGCAGGATGCACTCC
GTGAGCTGCTCGGCCGATACGCCGAGAAGCTCCGAGGCGTGGCGTACTGCCTCCTGTGACTCGACGTCGTCTTCGCGAATGCACGCAGTCTCGCCTTCTT
CTGTGTCCTCCTGGCTGATGTGAATGTTGCCCATGTGGAGCAGGCCAGCAACGAGGCGGAAAATTTCGTGCTGCGCACTGTCTCGGATGCCGATAAACTT
CAGCGCGCTCTTCAAGTTACCGAAGTTCTCAGCATCGTCGATGAGGTCGGAGCGCATGCAGCCCGACTGGTTCAGGTACGAGTAGGCCTCAGGCATCTTG
GGTTTCAAATGGAGGCTCTTTTCCAGATACTCGGCGTCGTCCGAGTGCAGCAATTCGTAAAACACGTGAAAGTTGCGTTCACCCTGTGGCTGGAACACCA
GCCGACTCTTCTCCAGCAAGTACGTGTCAATACTGGCACCCGATAGCTCATGGGTTCATTAGCGAACTGCAGTCTCATGTACTTGCCGAATCGACTCGAG
TTGTGGTTGCGGTGGGTCTTGGCATTGCCGAACGACTCCAAGATGGGGATTGTCTCCATGAGTCTTTCACCCACCGCCACAGGCGACAACTTCCTCTTGC
CGCTCGACTGCGGGTACGACATGGCCAGCGTAGAAGACCCAGGCGGACCCCTGCAGCCCAGCACCGGTCGGCTGTGAGCCGTGATCTCCGGCTCCATCTC
GTCGTCCGACGTGCAGGACGCAGAAGACAGCGCCGGGTTGTGCACGGCGCGCATGGTTAAGAAGTCGAGGATGATTTTGGACGTCTCCGTCTTGCCGGAG
CCGCTCTCTCCGCTGATGATGATGCTCTGGTTCTGCATCACCGCACGCACCGCGCAGAGCTGGCGGTAGGCGCTTTCCGCAACGTTGTACGGGTGGGGAG
GACACCGGTCCAGCGGCTGCCCTACGAAGAGCATCTTGTCCGGGTCAGGCACTTGCCGCAACGGGTTCACGGCGATGAGTACGTTGGCCATGAACGTGTA
CGGTCTCTGGTTCTGTAGACCCGCGCGGTCTTCCAAGTTCTTGGCCAGAGCAGCTTCATGCAAGTGTCTTAGCGACGTCATGTCC