Description :
From Genome Similarity Track
Location :
Scaffold_237:4533- 8800
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_237-fgenesh-gene-0.2Pro-apoptotic serine protease nma111

Sequence
4267 bases(100 bases per row)
TCACCAGAATTCACTGCCTGGGGAATGGGATCACGACGATGCGTGCGAAACGTACTTCCAGTCCCAGCCTTGGCGACGCAGCTCGACCGTTGGCCAGTAG
TGGTAGTCGGTCTTGAGCGTAAACACTTTCGGCTTTGTGTTGAGCGAAATGGTCTTAATTCGCACCGAGTCGGCGTTCTTGAGCTTGGTCACAACCCGCA
AAAAGTCGTCGAGGTGTTCGGTCTTTTCTCCATTCACTTCAACAATCCAGATCGTCGCACGGAGGCCGTACTTGTGGGCGGGCGACCCATAACACCAGCG
CGAGCAGTACACTCCACCACCTTCTTCTGGAATGTACCCAAGAGATGCCACCGAGAAATGCGGCGGTTGAATCACGAGCCCGCACCAGATAATCACGCGG
TCCGTACCCATCGCTGAGATCTGCGAGGTGTCGACGTCAAGCACGAGTTCCTTTTGATCGCGCAGCACTGTCAGCGCGACTTTTTCTTTGTCTGCCGCGG
CGTGTTCCACATCATAGTCACGCACCACGACCTTGCCATCGACAGCCAAGAGCAAGTCACCGCTCTCCAGCTTCTTGGCGCAGTCCGAGCCTGCAGCGCC
TCGCTTGATCGCAAGAATCTGGCGTTTGTCTTCATAGCACTGCGCGAGTTTCTGAATCCAAGCGTCGGATAAGCCTAGACCGGAACGAGCTTTCGACAGT
GGATACGTGAGCAGTTGCGCTGGAAGGAGATTGACAGTCGTAGGGATGATACCGACGCGAAGCTGGTCGATCACGGGCTTGACGATATGCACTGGCAAGC
CCCTAAATACCTCTTTGCGCCCAACGGCGTCTTGGTAGCTGAACGAAAGCCAGAGTGCGTTGACAAGACCCTTCTCATCCATGAAGACACCTCCGACCGA
CTTGGTGATGCGATCGAAATGGAGCACTTCGACGTTCATGGCCTTGAACCGCGGCGGCTGGAAGTCTCTCAGCACGAGGCGATCAATCTTGGTAACAAAC
GACTTCATCGTGACAACTGTCCACGTGCTGCTGAGCCCAATGTAGTCGCAGTGTACGCCGACCTCGAGTGGTGTATCCGAGAACTCGACACTCTTTAAAT
GCGAGGCGGCACCGAGTTCCTTGGGGTCGTACTGCACGATCGCGTAGTTGTGGACGGGGTGCACGAACACCACCTTGGCGGGGATTTCGATAGACGCGGC
AATGGTAATCAAGACGTCACCCAAAGCGATCGGCACAGTGTTTTGATCCACGAGCACAAATCCTCGTGTTGCATCAACGACGAGCCCCACACCGTGGTAG
CTTGAGCTCGAGATGCCGTCGATCATGTACGGGATGTCAAATGAAACCATGACGAGCGAAAGAAGTAGCTTCTTGCCCAGCGCACTGCCACCTGGGAAGC
TCAAAGGCGACGGAGCAATCGCTGGGATCGATGCTGCTAAGAGTGGAGTCGATGTGGCCTCGTCGTGCTTGCACTCGGTGGCGTACCACAAGCCGTCTGT
ATCGTTGCGCACCGATAGCTGCATCGGGAACCATTGGCGATCCATCATGATGAATGCCGTGCGCACGCGGTGGCGATCACGAATCATAAAGTATCGCAAC
ACCGAGCGATACCCATTGGGCAGTGCTGCCATCACGCGAACAAACGCGTCTAGTGTCGGTGTCGGCTTCCCATCCACGGCAGTGATGATCCCCGGTTGCG
TGAAGTGAGCTCGGAGAAACATGTGACCCGCCTGCGCCATGTACACGCCTCCGACGGGCAACGATGCATTCCTTGCTTGCTGATACGATAGCGAGTGCAC
AATGCCGCCGCCAATCTCAAGATACCTATCCGGCGTAATGGAATGGAGATCTTGGATGGCCAGTTCCACGGACAGCGACTCCCCACCACGCTGGATCACA
ACTGCCACAGTACCACCGACGTTTGCATCGAGGTAGCTTTCCAACCGCAAGAACGTTGTCTCGTACGACCCTGCAAACTGGATCAGCACGTCCCCCGTCT
GAAGTTTCGTATCGGCGGGGCCACCTTGAATGACTTGGTCGACGACCAGCATACCAGTCTCTTGCGGGTGCTTTTCGCGGACGATTGCTTCTGTCTCTGC
CGTGAGTCCGAGCCGCCGCACTTCATCAAACGCCGTGTGGCGAAACACGGTCTGGAGCGTACCACGAGGCACGCTTTCGCCACGCTGGATAAACTCGAGT
GCACGCACGACGCGGTCCAAGGGCAGATAAAACGACGACGCAGCCTTCTTGGCGCCTCCAGCGTTGAGTGCGATCGCGCAGCCGTCAATGTCGAGCACGG
GCGAGCCGCTCGAGCCACCGGACGTGCTGCTCGCAGCCGCGTAGTAAAACGTATTGAAGTCATTGTACGTGCTAGAACCATAGTAGGGCGCGTCGCGGTC
GAGCTTGGCCAGAATACCGGGTAGAATTGAGAGCTTCTCGCCTGCATCATTGCCCACAACACGGATCTCGACGCCGACTAGCGAAAAAGGAGTACTCGAT
TGTCAGCCACCGTTAGACCCGTGAGACGTCCGCGTCTAAAGAACGTACTTTTGGCGCCCTCGGGCTTGAGCGGGATCTCGTGGAGAGCGAGGAACTTGAC
TTTGGCCGGATCAAACCGGAAAAATCCGAAATCATGGACTGGGTCCCTAAAAAAATTGAGTACACAAAACCCAATTATTTTAGACCCCCATCAGTTATAA
TCGTGGGTGAGGAAAGAAAATGGCGCACCNNNNNNNNNNCAATTGAGTACACAAAGCCCCAATTAGATTAGCCCCCCAGCAGTTGTAATCGTGGCTGAGG
AAAGAAAATGGCGCACCTGTAAATGGGCACGAGGTCGACCTCTTCCTTGTTGAGGAAGATGGCGTCGGCGACGACGGGGCCGGGCGTGACGACGTGGCGG
TTCGTGAGGATGAGGCCGCGCGCCATGTCGACGACAAAGCCCGTGGCGACGCTAAAGGACGCGCCGTTGCCGTCGAACGCACGCACGCTGTTGAGGCGGA
TGCTGACGATCGCGCGGATACACTTCTCCAGCGACGCCATCCACTGGCGCGACTCGGCGTTGCCGTTGGACGAGGTCGTAGCGTCCATCTCGACGTCCAC
GGTCACGCCATCGACGCTGTACGAAGTGGTCTTGGTGGGCGGAAGAGCGCCGGACGGATCCGTGGGGGAGGGCGTCGAGGACGGAGCCGACGCCGCGTCC
ACCGCGATCTCCTCCTCCATGTCGTCGTCCATCGCGATCGGCACGTCGAGCGCGTCGTCCATTCTCTCCTGCGGTTGCCGTTGGCGTCGGTTGCCGTTGG
GGGGAAACGTAAATCCGATTTAGTGACATCCACCCACTCGAGAGATTTTTTTTTCTTTTCGTTGGAAGACCAATAAAACACAGAGTTCTGGGATCGCAAA
GGAAACTTCAAAGATAAATTTCGTACTTAGCTAGAGAGAGACACTACTGGAAAGCGACACACTGAATTAGGTTAGTTGACAAGATACAGACTCACTTCAA
CGTGTGCACGAGACTGGGGTAAGTCGGATTTCCAGTGTCAATATGGACCCTTTCCGCCGCGGCAGTTTGAACGTCCCTCCCGTTTGCAGCGCTACCTACG
TATAGCCTGGAGCGCCGGACGTGTACTTGGGTGGCGTGGTTTCTTCCTCTTGCGTCTTGGATCCCTGGGCGATCGCGTCATCTCGAGTGCGGTCGTGGGC
CTCTTTCGTCACGCCCTCGGCTTCCGGGCCTTCCTCCTTGTCGGGCGCCTTCTCCGCCGCGCCGTAATCTGGTCCAGGAGTGATCTTCTCGGCCTCCTGC
TCGCACTGCAAAACACCCTGCGGCTTGGTATCAGTCTCGCCCCCCACGTGACGCTGCGATTCGGCTTTACCAAAAGGCGTCTTCTTCCACGCCTCTTCAA
ACTCCTCTTCGCTTGTCGCCTCCGTGAGGGTCTTGTGGTCGCCTTCGTCGAGCTTTTCCTTGCGCTTCCACACCGACTTGACTTTCTTGCCGTCGATTTC
ACGTTCATGAACGGCCTTCAGTCGTCCAGTCGAATCCTCATAGCGGCGGCGCACACTGGTCACGCGATGACCGTTCTCGTCCAGGATGGTCGAGCTCGAG
TACGAGTACGACGAGTAAGACTGGCCCCCGCCTGCACTCCCCACCTTTTGGATTTTCTTCTCGTGCTTGTCGCCGTCTTGAGGCTTGCCCTTGCCTTCCT
TCATCTCCGACGGTGTCACCAGATCCTTGAAGAAGTCGTCATCGTCCGTGTGCATGCGGGGCACCAT