Description :
From Genome Similarity Track
Location :
Scaffold_70:4533- 6416
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17465hypothetical protein

Sequence
1883 bases(100 bases per row)
CGAGTAGCTGTGAAGGACAAGTCGGTCGTGCTAGTCGAGGGCGTTCCAGGGGCGGACAATTCGCTGAGAGTCGCTCGGACGCTGTGCACGGTGAAAAACG
GAACGGTTCTGGTCGAGGTGTGCAATGCTTCTACAGAAGAGGTGGAAGTCGAGTCTGGAGCTTACCTCGCTGCTGTGACTGTCGTACCAGAGTGGGCCTT
CACTACTGAAGCACCAGAGCGAGAGGGAACGCTGAAGAACATCAGTGCGGTATTAAGCGCCTCTAGTAAGAACGCCGAGACTCAGGTTGAGACGGAAGAG
GATGAAGAACAGAGATGACGATGACTTTGAGGTGGACTTCCAAGACTCATCGTTAGGGGCGGAACAGAGGAGACTTTTCGTGGAAATGCTGAAGGACATG
CGAGATCTGTTCGTCGAGACCTCCAAGAAGCCTGGGAGGTCAGAACTTCTGAGGTTCAGCATTGACACGGGAACGCATGTGCCGATAAAGCAGCCCCCGT
ACCGGGTTTCGAAGGCTGAAGGAGACGTTATGGAGTCTGAGATATAAGAATATTTAGACCTTGGGCTCATCAGGCCTTCAATGAGCCCGTGGGCGAGTCC
CGTGCTTATGATAAGGAAGACCGACGGTGGTATTAGATTCTGTATCGACTACAGGAAATTGAACGCCGTGACGGTGAAGGACACCTACCCGATGCCGTTG
ATCGACAACATCTTGGATGTTCTGGGGAACATCAAACTCTTCTCGACCATGGATATCGCTTCTGGATATTGGAACGTTCTAATGGATCCAGACAGTGTGG
AGAAGACGGCGTGCACAAGTAAGTTTGGATTGTACGAATGGCTTGTCATGCCGTTTGGCTTGTGCAATGCTGTTCCAGCTTTCGAGCGGTTGATGGAGAA
TGTCCTCGTTGATCTCAAGTGGAGGGTCTGTCTGGTCTACCTGGACGACTGGGTCGTCTTTAGTGACGATTTCCCTACTCATTTAGTGCGAGTACGCCAA
GTTTTGGAACGATTTAAGAAGGCCGGATTCAAGCTGAAGATGAAGAAGTGTCACTGGGGACGCGATCAGGTGGCGTTGCTGGGCCACATTGTGACTCCAA
CTGGAACCCTGCCTAATCCTGAGAAAGCGAAGGCGGTGATGAATATCGAGAGGCCGCATGACCTGGACACAGTCAGGACGTTCCTGGGGTTGACTAGTTA
CTTTCGGCGTTATATACCGGGCTTCGCAGCGATTGCAGCACCGTTGGAACGCCTGAAGCAAAAAGGGGTGGAATTCTTGTGGAACGACGATTGTTCCGAT
AGCTCCAACGAGCACTGGTGAAACCACGTGTACCCTAATTTCAGGAAGCGGTTCAAGCTCTACGTGGATGCATCTCACTTGGCTGTAGGGGCATGTCTGA
TGCAGGAGATCGGCAAGCGTGACCGGGCAATCGCGTATGCTAGCAAGATGTTGGTAGGCTCTCCGCGGAACTGGATCTACAAGACGAGTGGAACAACGGA
AATTGAATGTTGGGGAATCGTGTGGGCTACGCGTAAATTTAGATGCTACTTAGATCACGCCGAGTTCGGCCTGTTTACCGATGAGATCGGCCATCCGGAT
GGCGCCCACTACGCCGTCGTCCGGTCGGTGGTACAGCCTCGACAAGCCATCCACATGCCCCATCGACGTTCCCGGCCTGTGGTGCACCTTAAACCGTAAC
TGTGACAACTCCATAGACCACCGAGGCAACTTGGCGTTTGTCGTCCTCGTATTCTCACCAAAAATCCACGTGAGCGCCTGATGCTCAATGAAGAAGCGGA
AGATGAAGCCGATCTCGGAACGTCGAGTTCTGGAGTGACACGAACGCTGGAAGGAACGCCCGATCCCGGTGGAACGACCGTTT