Description :
From Genome Similarity Track
Location :
Scaffold_100:453272- 457267
Sequence
3995 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCCACTGCTGCTAC
GTCAAAATCTGGATCCGGACCCAAGACTGGGTCTACGGCGTCCAAGACTGGATCCGTTGCCCCATCCAAAACAGGATCAGCGGTGTCGACGGCCAAAACG
GGATCTACGTCCAAGACGGGATCCACCGCCGGTCCTTCGGTGACGACGCCGGCCGTTCCCCGGCCAGCCTCCATCGGCCATCCGCCAGCCCGTGCTGGAC
CCGGGAAGGGGAAAGCCAAACGTGTTATTCCCCCGGGATGTGGACTTGGCAGCTCTGAGGACGACGAGGATGAGGAGTCAGACTGGTCTGACGGCTCAGG
GCCTCCTAACCGATCGTCGTCGAAGCATACGCCGTCTTCCGGCCCGTATCCCTTCACTCTGAGCGATGAGGACGATGACGACGACGACGATGATGACGGG
AGTCCAGAGGATTCGGAGGAGGCTCAAGCCGCTGAGGATGCCTTGGAGGAAGACACGCGACGGTCTTTGTCCCAATCCCGGTCCGAAGCCCGGCGGAGAT
CCCTCTCGACGCCACCTCCACAAGTCGCTGGCACAGCCGGATCCGGAGGCGACACTGCGGGATCCGCGATCCAAGTCGACAGTGACGGCGGATCGGGTAG
TGATGGTGGGAGAGGGTCGCCTCGTGGTGGCGGACTCCTCGGATCTGGTGGAGGGGGGTCGCCTGGTGGCGGATCTCCCGGATCTGGTGGAGGGGGGTCA
CCTCATGGTGGTGGATCTCCAGGATCGCCCCACGGTGGCGGTTCCCCCGGATCGCCTCATGGTGGCGGATCCCCTAACTCGTCACTGCCAGGGATGCTCC
CCGTGGCTCCGTTTGGTCCGGATGCCGCTTTCATTCCTGGTAGACGTGCTCCCGTGGCCTTCGCTACCAGAGACATCGAGCCTTGGTCAGCCAAGAAATT
GAATCGAGTCGCGGTCATCTCCATGAAGATCACGGGTCCTGTTTCCGGAGTTGCCTTTTCGGGCTGAGTGGATATTCCCTCGGACAGCGGACGCCATCCC
GAGGGCCGGGTACGTGGATTCACTCATCACCAGACCTCTCGTGGAAGAACTGACAATTGTTGCCCCGTGGGATACGCTGGTCACCACACCGGTGGATCCG
GTTAGCTTCAGGGGTGATGTGGGCGACTCGGGGTATTTGTTCGGGCGCTCCAGGATTTCGCCTCCAAGCACCGAGTTGCTATATGGGAGGGCACTCACCG
GTTCCCCATCTCTCGGAATCAACTGCAGGGTTCGACTTGGTTGTCCAACTTCAACAAGCAGCGTGGTAACCGACGTAGTCATGCGGGCCGAGCTTGGAAA
AGAGTCCTTGTGATCCTCGTGTTAGCAATCCAGGACGGTTGGTGTGACGTGGATATTTTGCTGGATCCATCCTTCTTGCATCTTCCCCGACGCGGGGATA
AGGTGGATTGGTTTCCGGGATCCGCATCCCGTCAAGCCAACTTGGAGGATCCCAACCTCCATCGCCCAGAACCCACGAGCCTATTGGAAGCCTTGCGAGA
GATCGACGAAGCTGAGTCTTGGCGTATCCAGTTTCGCGGGGACTTGAGCCAGCACCCAGGACGCCAGATCCAGCGTCTAGTGGGCAAGTTCTTCAACGTT
CAGCCCAAGACTACCTGATCCTCATCACTCTTTTGACGCCACGCCCCCAGTTTCAGTCTTCGTGGATTCATTTCGTAGCAGTAGCTAGCGACTGGAAACT
GGGTCGAGCTAGCCCTTTGCATAAGCTATCATAATCCACACTCTCTTACTTGAATATGTCTATAACATTCCCTCGGTTGGTTGACAAATCTAATTCCGGG
TCTTTCAGTGTACATCTGGATCTGGGGCTGGAATCCGCCCTGTCAGTAGACAACCTGAAATCTGGGCTGGATTCTTCCTTTCAGTGTACACCTGGATCTG
GGCGGGATCCACCCTTTCAGTATACACCTGGATCTGGGCGGGATCCACCCTTTCAGCGTACACCTGGATCTGGGCGGGATCCACCCTTTCAGCGTACACC
TGGATCTGGGCGGGATCCACCCTTTCAGCGTACAGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTAGCGTGGCGGCGTGAAATCAATCG
ACAACATGAGGTCGCCCTCACTATAGCCAAAGATTATCAGGCTGTAGAAAAGGAGCGAAGAGCTAAAAAGCATAATGATGTTCTGAGTCGACTGGAAAAA
GCCGCTGTACCTCAACCAAGTGGAAACGAACACTCGGCGGACCCTCCAGAAGCTTCATAAGAGATGGAAGATCCTGCAAGAGCCCCACCGAGATC