Description :
From Genome Similarity Track
Location :
contig_47:453244- 455717
Transcript NameFunction/comments
g9285.t1hypothetical protein

Sequence
2473 bases(100 bases per row)
CGACACCATGAGCGACCTGCAGATGGTGGTTGGTGCCAAATGCTACGTGCCGGATGAGACGTACGTGTGGCTGCCAGCGCAAATACTGCGCGAGGTCAAG
AGCGTGGACGCCAAGAAGCCCGAGAAGACGCTGGTGCTGCGCGTGTTCCCTCCGCCGGGCGACAGCGGCACCGTTGTGCAGGAGGAGCGCGTGCTGGACT
TCAATGACCCCAAGGTCAAGGCCATGCTCAAGGCGCTGCAGCTTGAGTCGCTGCCGTACCAGAACGACAAGTTGGGACCTGAGGGCATCGAGGACATGAC
GGCGCTCAACTACCTGCACGAGGCCGCCATTCTGTACAACGTCAAGAAGCGCTTCCTCCAGGAGCTCCCATACACCTACACGGGGGACATTTGCATCGCC
GTGAACCCTTATCAGTGGCTGCCTGAGCTTTATTCCGAGCAAGTGCAGTCCCAGTACCTCACCAAGGCTCGGAATGAACTGTCGCCCCACGTGTACGCCA
CGTCCATGGCGTCGTACAACGACATGAAGCGCCACGAAATGAACCAGTCAATTCTGGTGAGTGGCGAGTCTGGTGCCGGGAAGACCGAGACGACCAAAAT
CCTCATGAACCATTTGGCCTCCATCGCGGGAGGCTTGAACGACTACACGATCAAGAAGATTATCGAGGTGAACCCCCTACTGGAGTCGTTCGGTAATGCC
AAGACGGTGCGCAATGACAACAGCAGTCGATTCGGCAAGTTCACCCAGCTCCAGTTTGATAACGCGGGCATTCTAGTGGGAGCCCGATGCCGCACGTACT
TGCTGGAAAAGACCCGAGTGATTTCCCACGAAGAGATGGAGCGGAACTACCACATTTTCTACCAGCTGCTGTCTGCTAGTGACAGCCAGGAGCGGTGGTT
TCTGGATGACACCAACGAGTGCTATGCGTACACGGGCGCTAACAAAACGATTAAGATCGAAGGCATGTCGGATGACAAGCACTTCGAGCGCACTAAAACC
GCGCTTGGACTCGTTGGTGTAACGGAGCAACAGCAAGAAGTTCTCTTTGAAGTGCTTGCGGGTGTACTGCACCTTGGACAAGTGCAAATTCAGTCGAAGA
ACAATAATGAAGAGTCAGCCATTGTCCCTGGCGATCGAGGGACGAAGCATGCAACTAAGCTCCTCGGTATTTCGGCAGCAGACCTGGAGAAGGCTCTGTG
TTCGCGGCAGATCGCCGTCGCTGGTGATAAGGTGACGGCCTTTTTAAAGAAGGATCGAGCCGAGGAATGCCGTGGTGCGCTGTCCAAGGCCATTTACTCT
AATGTTTTTGACTGGCTCGTCGCAACGATCAATACGTCACTGGAGAACGACAGGAAGATGCGCCATCACGTCGGAATTCTCGATATCTTTGGCTTCGAGC
ACTTTAAGCACAATTCCTTCGAGCAGTTTTGCATCAATTACGCCAACGAGAAACTCCAGCAGAAATTCACACAAGATGTCTTCAAGACCGTCCAACTGGA
GTATGAAGCTGAAGGTATCATCTGGAGCCATATCGACTTTGCGGATAACCAAGATGTGATCTCAGTGATCGAAGATCGCCTCGGTATTATTTCGCTGCTT
AACGACGAAGTGATGCGCCCTAAGGGCAATGATGAGTCTCTCGTTTCCAAGCTCTCAACAATTCACAAAGACGAGCAGGATGTCATTGAGTTTCCGCGTA
CGTCGCGCACGCAATTCACAATCAAGCACTATGCTGGAGCAGTTACGTACGAATCACTGGGCTTCCTCGAAAAGCACAAGGATGCACTTCTCCCAGATCT
GTCCGACTTAATGCGCGGGTCGTCCAAACAGTTCCTTCAAACAGTATTTGCCGAAAAGACTGGCAGCTCTGGAGACTCACGAAAAGCAGGGCGAAGCACT
AGCAACGCTCGAGGTCTGGGCGGTCGAGGCACAGGAGGTGCTTTGACGGTGGCAAACGTGGGTACACAATTTAAGGACAACCTCAATGAGCTCATGGCCA
ACATCCGGCAAACCAAAGTACACTATGTGCGTTGCATCAAGCCCAACCAAAACAAGAGTCCAAACGAAATGGATCAGCACATGGTTGTATCACAGCTGCG
TTGCGCTGGCGTGATTGAGGCAATTCGTATTTCACGCGTTGCGTACCCGAATCGACTCCTGCTGGAGGGTTTGGTGGACAAATTTTGGATTTTTGACGTG
CAGCATCGCAGTACTGACATCTCCATCAAACGGCGCTGTGAGGCACTGATGGGGAAGATGGAGTTGTCCTCGCCTGAACAATACCAGATTGGGCTGTCGC
GCATTTACTTTCGGTATGGTATTCTGGAGCAGATGGAGGACAAGAAGGCGGTGCGGCTGGACCTTCAAGCTCGACACCTGCAGCATTTTATGCGTGGTTT
TTGCTGCCGGTTGCGCTACCTTCGCAAGCTGCGAGCGATTGTGAAGCTACAGGTATGCATCTCTCGTGCTGTT