Description :
From Genome Similarity Track
Location :
Scaffold_411:4532- 5758
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_411-fgenesh-gene-0.06-phosphofructo-2-kinase/fructose-2, 6-biphosphatase

Sequence
1226 bases(100 bases per row)
GCGGCAAGCTCATCATCTTCCTCGTTGGCTTACCCGGCCGCGGCAAGACGTTCATCGGCCACATCCTGGCGCGCCACCTCACGTGGATGGGCCACCACTC
AAAGGTGTTCAGCACGGGCGAATATCGCCGCAAGGCCGTCGGCGCGAGCATCAACCACGGGTTCTGGGATCCGCTGAACGAGGAGTCGTACCACATCCGC
ACGGAGCTCTCGAAGCAGTGCCTGCACGACTCGCTGTCATCGCTCGAGGACGACGAGAGCGACTGTGTCATCTTTGACGCCACGAACGTGACCCGAGCGC
GCCGCGAGATGCTGCTGTCAGAGATTGCGAATCGCTTCAAGTGCGAGGTGATGTTCATCGAGTCGGTGTGCGATATGCCCGAGGTTGTGGCGTTCTCGAT
CAACGAGATGAAGCTCAATTCGGAGGACTACGCCGGGAAGACTCTGGAAGAGGCTGCGACGGACTACAACAACCGCATCAACCATTACCGGTCGCTGTAC
GAGCCGCTGTCGGCGGAAACCGACAACTACCCGTTCATCAAGGTGATTGACGTGGGCCGCCAGATCTTCTGCAACCAAGTGTACGGGTACCTTCAGTCGC
GGATCATGTTCCTCATGGCGAACCTGAACCTGCGTCCCCGCCCGATCTGGCTGAGTCGCCATGGTGAGAGCATGTATAATACGCAGAAGCGCATCGGTGG
TGATTCTCCGTTGAGTCCGCTCGGTCTGCAGTACGCGATGCAGCTCGACCGGTTCATCAACGCCTACTACCCGGCTCCCGACACGGAACTGGCAGTCTGG
ACGTCGACGATGTTGCGCACCGGTATGACGGTGGATCGCATTTCGGCGCGCGGACGGTCGGTGGTCAAGTGGAAGCAGCTGGACGAGATCGACGCCGGAG
TTTGTGACGGCATGACGTACGAACAGGTGGCGGAGGATATGCCCGACGAGTACCTGGCACGCAAGCACAACAAGCTTCACTACCGCTACCCGCGGGGCGA
GTCGTACCAGGACGTGATCCATCGCCTCGAGCCAGTCATCACGGAGCTCATGCGGATCGACCAGCCCGTGCTGATTGTGGCGCACCAGGCGATCTTGCGC
GTGCTGTACGCGTACTTGACCAACAAAGACCCGACCGAGTGCCCGACGCTCAACATCCCGCTGCACGTGGTCATCCAGTTGACGCCGAAGGCTTACCACT
GCGAGGAAGTGTGGCACCGCCCAATG