Description :
From Genome Similarity Track
Location :
Scaffold_4:453130- 459040
Transcript NameFunction/comments
Physo_128242reverse transcriptase
Physo_128243hypothetical protein

Sequence
5910 bases(100 bases per row)
CCGAAGCCCTGTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAAC
ACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGTACGCCATGGGGACTTAGCCCCTGAGAGTCTCTGAACTCTAGAAGCGGAGAAGGGCAGCGGTGGGCTG
CTTGTGGTGCACGCGAGTGTACCGGGATACGATTATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCAC
GCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGAAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGT
CCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGG
CTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTCAGTCATGTTCCCACCT
CTGCCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCATCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGG
ACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTACTGGAG
AAGGCGCCGCTGGTGTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGACCGTAACTGATGAGGAGGCACTGCAGGCGCTTCCGATGTGGGTAAAG
GAGGTCACTCAGACCATCACTGATGCGGAAGTTGCTGGAAGCGCTCCTGATGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCA
GCAAGGCGGGTAACCAAGTTCCGCTCAAGAACAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGCCGGGTAACGTAGTTCCGCACGAGATCGAGAAGAT
CGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGGCACCCGAGGGTCACGTCGTAACCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGAC
TCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAG
CTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCT
CCGACCGGAGTCCGCGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCT
GAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGCCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGC
GACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCCGGGGCTTTCTAACGTTCCGGCAACGTTCAATCGCT
TGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGA
GGTGCATCTCCAGCACCTTCGACGTGTGCTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAG
GTCCTGGGCAGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGGCCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTAC
GACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTG
GCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGTGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGC
GTAGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGTTGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAA
CGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTTCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATA
CAGACCATGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGCCATTCTTCGCGGAATACAACTTCCGTGTCGA
GTACAAGCCAGACAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGAT
CGCATCAGGCTGGGGTACCGGGACGATGCCAGTCTCAGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGAC
AACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAAGA
TCACAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGG
CGTCACATGTAAAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGC
CGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGTCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCG
TCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTG
CCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGG
ACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATTGCGTGATCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCG
CTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGTCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGTCGCTC
ACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAA
GCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCAAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGA
AATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAATTCTCCTAGATACTAGAAACCTACTGTTAGCTCGGTCGAAAGCAACAAGCTGAAGCA
CCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGT
CGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCCTGATAGAGCGAGGCAA
CATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACATG
GTCCCGGAGAAGCCGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGAGGCTCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGC
GAGGCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGTGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAG
GGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTT
CGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTG
CTTCAGCTCGTCCATCTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGA
TCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGTCAGAAGAGGTCTTCCACCACGCTCCAGGTCATGTTGTCATTCG
GCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGC
TAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATA
AGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCAGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAG
AAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTACTCGTCGAGGTCGTTGGAGAGCTC
CTTGGGCTCGTGGACGGCACCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCG
CCTTGGCCTCGGCGGCTTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTT
GGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCTGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGAC
TCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCTTGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGC
TGCTCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTT
ATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCAAGCCCCGGCCTGACAGCCACTCTCCGGCGTGCTGCTACGAGAGCGC
ACCTCCTCCTCGGCCGCCTTCGTGGCCTCCATCGGCGCGGACGACTCGTCCTTGGCCTTGTCCGCTCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAG
GTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTTCAGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCC
CGGGTGCCCG