Description :
From Genome Similarity Track
Location :
Scaffold_29:45311- 51790
Transcript NameFunction/comments
Albla_Nc14031800callose synthase putative

Sequence
6479 bases(100 bases per row)
TGCTGGCGACTCAAGTCGCTGGTAATTGCTCTTGTTGGTGACGTTGGATCGACCTCGAGAGCGATTGATGTTGCGATTCCTTGGACCGCCTGAGGGCAGG
TTGGGGTTACTGGTTTGATGTCGTAGACCGTACCGCTTATTTTCAGCAGCCATCTCCTCTTTGGTGCATAGTATACCATTTCTCCGCGTACCTGCACCCA
TCAACAGCACCATTGTCGTGATGCAAAACAGTGTCAGACCATATAGGAAGATATATCCACCATTCGGTACCGTTTCCTTTGTTGATGCAAAGGTGTACGC
AATGGGAATAACAAAGAAAATTGCATAGAGCACCGGTGTCATCACAGCCCGACCACGAGTCGTGAACAATCCCACAACGGACGCGTAAGGAACGACCGTG
AAGCCAAGACCAAGGAAGAAGTAGCAAAGCATCGAGGTCAGACTCATACACAAAGCCGCATTGCCAGTTTTCGTGAATAAATCCGTCTGAGCATCAAAGC
CAAGAATTGCAGCACATATGGACACAGGGATGCATGTACCAAATAAGATGGACTTGTGGTTAAGCTTGTCGATGAACAGGAATGAAAGCCCGGCGCCGGT
GATTTGAAGCGCCAAACAATTCAGCAGAAGCCGATATTGATCACCTTTTGCTCCAGATGTTTGCTCATGGTAAATATACGTATTCAAAACTGGAGTCGCT
AATGAGCAGGTGATGATCAAACTGATGCCCAATAAAAGCTTAAAGGACGATGAGACTTCTTCATTGCTGGATCCTTCACCATCTTCTTCCCGGATCTTCT
TCAGTTCATCCAAAACATCAGGCTTTCGTCGTAAAACAATCAGACAAGCCTCGCAACAATCCCATCCTCGATGATCTAAAATCCACAAAGGGCTTTCAGG
GAAGATGTTGATTCCTGCAGTGATCATCCCAATCACACCGGAAGCGATAAAGCCTTCCCAAATCCACCCAAGTTGCTTGATTGTGGAGCAAAAGCAGTTA
ATGAGGACACCCAACGTGAATCCAAAGCCCAACAATAGCATCGTTCGACTTCGCATTTCTCGTGGAGGGACTTCGTAAATGTACTGCGATAGTGATGGAA
ATAGAATACCAGTGGAGATTCCCATTATTCCGATCGCAGGGAGAAGCAACGATTGACGCGATCCTCCCGTAGCATACACAGCTGTCATGCCTATACTTGT
AAGCAGACCACCAACCACAATGGAGAGCCGACGACCAAGGAAATAGTTCGTGAATGCGGATGCGACGACACCAAGGGTACATCCAATGTAGTAAACATAC
GAGGTTTTACCCTTGCCAACGCCTCCGTCAAGAATACCGTCGTACGTGATCACATAACTGGAAAAACTCGGAGATTGTTCCAAAGTCGATAATAAGCTGA
ACAACCAGCCCACTCCAATACCTCCGAGAAGCCCGATAAAGGTAGCGATTGAGAACGCATACTGAGAGGACGCTGACATGACTTTTGAGAAACCTTCGTT
GTACATCATACGCGTCTGTATGATATTCAAAAAGGGGATGCAGGACATGATGAACAGCGGTATGACCAGCAGTAAGCCAAATATATAGTCGAAGAAGAAA
GCTAATTGCTGAAAGCAGACGATACTGGCAATGGAAGAGTGTGAAAAGCTCCACATACGTGCACACTCATTCAACCCATACAAAGCTGCCATATAGCCAA
AGAATAGGGCGATCGCATAGCTTATATCTTTACCCAAAATGGCAACGATCGCGATCAAATAAGCCGTCAAAATAGCCAGTAGACAGAATGCGTAGAACGA
TGCTCTTTTCATTGCAGTCATTCCACGCATACACAATCCAAATCCGTGAATAAATCCCATTGCGACTATAGTAGCTCCTGCAGCGCCCAATACGAATGCA
ACAAACAAGACGTTTTTGGTTTGGAGTGTGATCACGTAAAACATGACGAAGAAATGTCGGCTTTCGCGTATGACCACCGTGAGACGAGAAATCATATTGG
AGTTGTGGTACTGCTCAAGCTCAGTTTTCCACCAGGTGACCCAGCCGCCCGTGATGGTTTTGTCATCATCTTTGTAATCAGCATCGGCAAACATCCAATT
CACCCAGGCTCTAATATCGACCTTGGTCTTTTCCCAATCCAAACCGTCCGTGTTGAAAATAAATGGAGACAAGAGCCAAAGAATGGCAATGAACCACGTT
GAGAAAGTTTGCACACCGTAACCTTGTGACGCATTACAAAATTTGACCGCAAAAAAGTCAGAATCTGCTGGGGCTTCATTTTGACAGATAGAGAAATTTC
CATATGCTAAATAGAGAAGACAAAGTCCCACGAGCTCGAATGCCTTTCGATAATGAGAGCTGGCATACGCTCGATATAGCAAGACAAAAGTCTCACGCGT
GATTTTGAATCCTCGACCAGTAGCTTGATAGTTGGCTCCTCCGTGCACAATGTTGTTGTCAAAGAAATGCATGGTTGTGCCGACTTGGAATACGAAGAAA
GCGGGTCCTCCAGTAATAATCATCTCGATAAATCGTACAAAACCCCGCAGTAATCCTCCCTCACCAAAATATACGCACATCAACGGAAGCATTAGAAACA
GCCCGGCCTGGATGAAAAACTGTGTATTCATCACGGACTTGATGTCCGTAAAGACGCGGAGGTCAAAGCCATATGCCACATTGCCACGGATAACCTGTGT
CGAATTCATCTCAAATACAATTTCACGTTGTACGCCAGAAAGAGCCAAATAGACTTTGCTGTACATGTACACAAAAGTGGTGACAATCGTCATCCATGTG
GCAAAGTAAAATCCTGTGTGTGAGTAATACATTGAATTGAGGCGAAAAAAGTCCATAAACTGCCCCATACGATGCGCTTCTCGAGCCAAAGAGGTTTCTC
CGGCTCCATTTGCAAGTTTCCCCTCAAACATGGAGATTTGCGATAGAGCGACATCACGTCCTTTACCGCATTGCATAAATTCCACATGAGTGACGATACC
CCCACGTAAGGTCGAATTGAAGCCGGCGAACACATCTTCCGAAAGATTGATTCCCTTACTCGCCTTTGAGACACCTCCACGAGAGAAGGCGATCAGCTTG
TCAAAGATATCGGGATGACCATAGTGCATCCGAACGTATAAAGGATCAGCCAAGACACGCTGTGAGAGCGTGACGAAGACAAGCTCTTGCCAAGATTTGA
ATTTCGAAAGAGAAGATGCATCACCAGTGAAAATATGCTCTCGCATTCCAATGATCGAAACGGGCTTTTTCGAAGGATGGAGGTCAGCTGTGGCCAATAA
TTGCGGCATTTTTAGACATTCTTCGAAATAATGTTGCTGGTTCATGTCGATTGTTTGCAAATATTCCCCACGAGTAAATTGCAAAGCATTATTCTGATTT
TCTGGTTTGCCTTCGCCTACAATTGGATCTCCAGGCAATTCGTAGCGATACACTTCGACTATTTCATTTCTTTCACTTTTGATCAGCACCGAGTCGAATC
GATCGTCATGTCCCGTGGATTTGATGGTATCAACATAGGCCACACGAAGATTTGGATACGTCTTGAGAAGGTAATCGATGTCATCAGCTTGGGCTTTACC
TTCGGCGCGATGTTTTCCGTACACTTGACAGGCGCAAATGTAAGAAAATTTGAGACGAACGATATCTTCGAGCTGTGCCTGTTTTTGTTCGGCAGTCTTA
TTGGGTGCAGAGCCAATTTCCAGCCAGTGAAGAATCTTGATTGCATCCTCGTACAGCATCATCCCTTGCACGGTCCGGGAAAGCGTTTGACCACGGTATG
AAGCCCACAATCGAAGCTCCATGGGATATTTTCCCAAAGCTTCCTCGACAGACATTACGTCGATTCGTTCAAGAAAGTTCTCCCATTCCGCTGGATGGAT
CGTTGTAAGGTATTTGAGAATGGTGATATTTTTGCCATCCTCTTCCACTTTTCTAAAGATTGGAGGATTGTCGAGTTTGTCGCTCAGCTCTTGCAAGGAA
TATAAGACGGACTCTGAGTAGAACGGTGTTACGACCGAAAACGATTTCATTTCCTTGATTGCAGTGAGCTCGGGAATTTCCATCACCAATGACTTGAGAA
AGAATCCCAACCGCCGCTGAGCTTCCCCACAACGAGGCATTGCACCAGCTCGATCCAGAGTCATGAGCAGGTACGCTCGCGTTGCTGCGCCCATAGCAGC
ATCGTTGTGAAAAAGATTGATTAGCCCGTTCATTGCGTACATGTATCCACCGTTGGCTTGGACAAACTTGACATTGGAAAATTTAGCCCCTAAATCGGGT
CTACCAGCCAAATTGCGTAGATTGTTCATCAGGCTTTCCATCTTAGTGACAAAGCTTCGAATAACTCCCATAGAGTGCACTTTACTCGGCCCACTCCCTT
GCGTTTGTGATTCTGGATCAGGCAAGTCCATCACAGCTTCGAGTACATCCATGATAGAAGAGCGAAGATGCGGTAAAGTTCGAGTATCAAAGGTACTCAG
AAACTTTCCACTTTGAGCGATTTTCTCAATTTGACGAAGTGCATCGAGCACATCAGCGTCTTCCGTGGTCAAAAGCGCCTCGAATACATACATGCAAGCG
TTGAAAAAGCTTCGAATGCCAGATAGACAATCCTCCTTCATAAGAGCGATTTGCAGCTGTTCATCCGCTTTTTGCTCCTTACTGAGCTTGGCAACAATCT
CCAGGGCGTCATTGAGCTTGCCTGCTGATAGAAAAACAGGTTCAAACACCTCGCCGGAGCTTTGTACGTCATATTGCAGTATCGCAGCTTCTTTATCATC
GACCAAGTCACCTTCTCGAAACGAATTGACAATCTCATTCCAAACAACTACAAATCGAAGCATCATTTGAGACTGAAATTCCGCCGCAGAATGGCCGTGT
GTAGCATCATTGGCCCGTGCTAAAGCTGTGACAATTTTGTGATCAAACAAAGGCGGTGCCGCACGAAAATACTTTGAGAATTGCTGCATGCCGTGAATTT
CACCAGTTTTCATAAATATTCCCATAAACCAACCGAGCAGAGCCTGAAAGGCTGTGAAGTAAATTTGCGTGTCGTAATTGAATATGAAAACGACGGGAGC
CCATAGAGCCAGTACCACTCCCATGTTGTGGAAAGAAATCACGTTAGTGCCATAATTGAGCTGCATAGAGTAGATTGCCAGTGAGGGAAGGACTAATGGT
CGGACAAGGATAAAGTACGATACAAACGCTTTTAGAAACCACAAACAGAGCCAATACGCAATGTAGCGAAGTTGGAAGCGGAACGGTGGAGCCATATGAC
GTCCTACGTAGCAGCTATCACCTTCACGGGTAAACTTGGCCAAATAGCTTTCATTGATCAAATGAGGTGCTACTGCGTATGCGAGGAGTACACCTGTTGC
AGGGGTAATAAAAGCCATGCCCATCAAAACGGCATTGTTGAGGAGCGGAGTGTCCTGACCGGTTGTTAAAGGCTCGTAAATCATCCACCCGAATCCTGCT
GCAAAAGCTGCATTCCAAACCGTTCGACAAACCAAAGCTGACGCATATGAAAACGATCGAGATGCAGTTGTAGCTTTATCACGAGTGAATAAAAGATGCC
ACCCATGTGCTGCCTCCAAAACTGTTTTAAGAAACGCGAGTAGCGAATGGCTGAATACAATTGAGATCAGTGCGAGCTTGACATCCCGTTTGGTGTACGG
AGCGACCACTTCGCCCATTGAGCCGAATTGAGCAAACCATTGCTTTCCACCACTTGGTGATACTGCAGAGATAAAGCTTATCACAATGAGAACGGTGAGG
AACATCAGATTGAACTGAAAGATCCGATAGTAGTTCAAAATCAAGGTAAATATACTTCGGTGTTCATAATATGATTTCCCGTGGTTTTGGCTCAATTCTT
TGCCGATTCGATCAATGGGAACTTGAATGCAATAAGGCTTCCAGAAATACTCATTAATGTCGTCATAATTGCGCACGTGGACATGTTCTAATGATTTTCC
AAGTTTATTTTTTCGCTTCATGTTGGCACATTCCGCCCAAACTGGACGAACAACCGAACGAAGGTACCATCCTTCACTTTGAGTATGAGATCCACGAGGA
TCTTGATTCAATTGATGCAGCATCTGATGAAAAATATAACAAAGACATTCAGGCATGTGTCGTAGATTCCCAGCTTCTCCCCATATCAGTAATAGAAGCA
TCATGTCCATATGTAGAGGACTTTTCAAATTGTTCGCTTCTTGCGCTTTAAATGAGTTCGGTTGGATTCGGAGAAATTGACACCACTCGATATAATTCGA
TACCAGCTTCTGATGTAGTACTCTAATATGATGCTGGGGAGGATCAGACGGACGAGTTCGAGCTTTACCATTGGCAAGAAGAAGAAGCACATGTTCTCGT
TGATTGTTTACTGAGCCAGATTGAAATCCGAATTTGTTATATAGTGTTTCGCAGCAGTAATCAATCGAGGTTTCATCAT