Description :
From Genome Similarity Track
Location :
Scaffold_3:453002- 454211
Sequence
1209 bases(100 bases per row)
agctcgtccaacttccggtacagttttattccatcctccagcttcattatcatcggattccgatcgttcgtctcagaatacgatgaacaccatgtcggac
ttttccttcagcagcgatacactgtttgatatgtcgactttcctccctgggagcttctctgtgtcccgtaacattgaggacgagctggaagctgttctca
aggcgaaacaactggagaaagaggtggaagcgagtcagcaacggatccaggatttagaggcacagattgccagtcaagagagccaacaagacctcctttc
agctgaacaacaagtacagcttaaagacgcccgagcgaccattaaactcttgcaggaccaactccgtacacaggaggtgaacgccagacaagcagcacag
aatcgagactccatttgtctcagtaaactccgacagactgaactgtacgcgaatgaagacgatgagagcaacgcactgaagaaaaagctcaaagtactgg
agagacagctgaaacaagctgggatctcggtggcggaggtcattccgtatgaattagccaagcggaaagtgacggaaatctccaaaagactgcaggaaat
cgggtcttccgagatcgttttacacgacaaacaagctcaagctgctgctcggaaggaatattacatcttagagcaggagatggagaagtatcacatggct
ctggtcatgacggacgagtatatcgaagagcagcgtcgacaggaacaggagtgggaagacgccaatgagacagcgaaccgagaagctttacgacgactga
gatctacgattcctgtggacatttcacggctttcggaacgagaattgattgagttcaagacgcccacaggagttgaattccctgctgaacttgctcgacg
gctgaaacgtaccaacgtacttcaattgctgcgaacggacccgaaaaccatcgtgaaaatgcacccgagcgtcatcgaagggtaccgtacaactggcatt
acactcttagagcgtcgagcactccacgccgtgatgaaagagccgcatcaggagtggaaaaagcagcaaaaagacgaaatggcgcagaagaaatacgcct
ggtactgtaagctgaaagaggctttcgtcacggctgctgcgaatctccaaagtcattgcaaagacaccgtggaagtgactttgatccttcacaacactcg
tgtgagcta